We are not affiliated with, endorsed by, authorised by, or otherwise connected in any manner whatsoever with the Government e-Marketplace (GeM) or the Government of India. We provide independent advisory and consultancy services only and do not act as or represent ourselves as agents, representatives of any government authority or government entity or government company.

🔴  3 Indian Council Of Agricultural Research icar tenders closing in under 3 days — review & act now —  Review & act now
Indian Council Of Agricultural Research icar Tenders — Updated July 2026

Latest Indian Council Of Agricultural Research icar Tenders — Updated Daily

ICAR, the apex body for coordinating agricultural research and education in India, floats tenders for lab equipment, seeds, chemicals, IT services, consultancy, infrastructure, and field studies. Whether you’re looking for icar etenders or ICAR tenders by institute, GeMTech PARAS provides a central platform to access all active ICAR procurement opportunities.
Read More

GeMTech PARAS aggregates live Indian Council Of Agricultural Research icar tenders in one searchable platform. Every active tender is indexed, filtered, and matched to your company profile automatically. Stop manually checking portals — let the data come to you.

256
Indian Council Of Agricultural Research icar Tenders Tracked
432+
Clients Across India
4.9
Google Rating
24hr
Response Turnaround
98%
Compliance Rate

    Indian Council Of Agricultural Research icar
    Showing 1 to 25 of 256 for Indian Council Of Agricultural Research Icar Tenders
    Indian Council Of Agricultural Research icar
    Expired Today
    Nucleotide sequence;291;CGG AAG ACT TGC TCT TCT TA , GTT ATT TGG TGC ATA TAA TAC ATA , TCA GAT CCC AGA AGA CTT GTT AAT , ATG TAT ATA TGT GTA TGA ATG TAG TAC TCG , GAT CTG GAT GTT CAT AAG G , GAGGTGGAAGAGTACGGTTGTG , CCTCACAATTTCAGTCAACATCGT , GCCACCTCCTAGATGTGGTCATA , GTCCATCCAGGTGTTTCACG , GGCATAGTATTCCCTAGAAGAGAGATAAC , TGTTGATTCTTAGAATGGTAAATCACAG , TTGAAAATCACATGTATACATATGGCTT
    End Date Expired
    Location Bharatpur, Rajasthan
    Department Department Of Agricultural Research And Education dare
    Amount Refer doc
    Amount: Refer doc
    Indian Council Of Agricultural Research icar
    1 day left
    Repair and Overhauling Service - Tractors (V1); John Deere; Yes; Buyer Premises, Service Provider Premises
    End Date 08 Jul 2026 12:00 PM 1 day left
    Location Jalandhar, Punjab
    Department Department Of Agricultural Research And Education dare
    Amount Refer doc
    Amount: Refer doc
    Indian Council Of Agricultural Research icar
    Expired Today
    5;GCMS and Delivery Tube , NIL1 , NIL2 , NIL3 , NIL4
    End Date Expired
    Location Bengaluru, Karnataka
    Department Department Of Agricultural Research And Education dare
    Amount ₹ 80 L
    Amount: ₹ 80 L
    Indian Council Of Agricultural Research icar
    3 hours left
    Custom Bid for Services - Soyabean Meal
    End Date 06 Jul 2026 05:00 PM 3 hours left
    Location South Andaman, Andaman And Nicobar
    Department Department Of Agricultural Research And Education dare
    Amount Refer doc
    Amount: Refer doc
    Indian Council Of Agricultural Research icar
    Expired Today
    Thermo Fisher Scientific Brand Only Supply;30;Dream Taq DNA Polymerase 5U 500 U , Taq DNA Polymerase 5U 500U , dNTP Mix 2 mM each 1 ML , Na , Na1
    End Date Expired
    Location Bharatpur, Rajasthan
    Department Department Of Agricultural Research And Education dare
    Amount Refer doc
    Amount: Refer doc
    Indian Council Of Agricultural Research icar
    7 hours left
    Custom Bid for Services - 3800000
    End Date 06 Jul 2026 09:00 PM 7 hours left
    Location Visakhapatnam, Andhra Pradesh
    Department Department Of Agricultural Research And Education dare
    Amount Refer doc
    Amount: Refer doc
    Indian Council Of Agricultural Research icar
    3 hours left
    5000;Ginger seed -IISR, Varada at KVK, Dhalai
    End Date 06 Jul 2026 05:00 PM 3 hours left
    Location Kozhikode, Kerala
    Department Department Of Agricultural Research And Education dare
    Amount Refer doc
    Amount: Refer doc
    Indian Council Of Agricultural Research icar
    2 hours left
    Procurement of chemicals;591;Sodium Hydroxide pellets NaOH , Ethanol , Sulphuric acid , Sodium Bicarbonate , Ammonium Acetate , Ammonium Ferrous Sulphate , Potassium Dichromate , Potassium Sulphate , Calcium Chloride Dihydrate , Dimethyle Sulfoxide , Cupric Sulphate Pentahydrate , Methanol , Ferric Chloride , Whatman Filter paper No 42 Dia 125mm , Hydrochloric acid HCL , Sodium Acetate trihydrate , Pottassium dihydrogen orthophosphate , Sodium carbonate anhydrous , Potassium sodium sulphate , Disodium Hydrogen Arsenate , Ammonium metavanadate , Ammonium molebdate , Nitric Acid , Perchloric acid , Trichloroacetic acid , Ferrous sulphate , Ferric Chloride hexahydrate , Ortho phosphoric acid , Glacial acetic acid
    End Date 06 Jul 2026 04:00 PM 2 hours left
    Location Pune, Maharashtra
    Department Department Of Agricultural Research And Education dare
    Amount Refer doc
    Amount: Refer doc
    Indian Council Of Agricultural Research icar
    1 day left
    1;Procurement of Atomic Absorption Spectrophotometer (AAS)
    End Date 07 Jul 2026 05:00 PM 1 day left
    Location Central Delhi, Delhi
    Department Department Of Agricultural Research And Education dare
    Amount Refer doc
    Amount: Refer doc
    Indian Council Of Agricultural Research icar
    3 hours left
    Chemicals;75;Twist Amp Basic Kit 96 test , Milenia Hybri Detect 1 , Oligonucleotides 5 Biotin Modification 100nm Scale , Oligonucleotides idSp 1 5 6 FAM 3 C3 Spacer Modification 100nm Scale , Oligonucleotides 25 nm Scale
    End Date 06 Jul 2026 05:00 PM 3 hours left
    Location Kasargod, Kerala
    Department Department Of Agricultural Research And Education dare
    Amount ₹ 2.31 L
    Amount: ₹ 2.31 L
    Indian Council Of Agricultural Research icar
    One hour left
    Repair Works at ICAR IIOR;5;Repairwork 1 , Repairwork 2 , Repairwork 3 , Repairwork 4 , Repairwork 5
    End Date 06 Jul 2026 03:00 PM One hour left
    Location Rangareddy, Telangana
    Department Department Of Agricultural Research And Education dare
    Amount Refer doc
    Amount: Refer doc
    Indian Council Of Agricultural Research icar
    1 day left
    CCTV;1041;Dome Camera 2 MP , Bullet Camera 2 MP , NVR 8 port , HDD 4 TB , POE switch 4 port , POE switch 8 port , Cat 6 cable , Two U Rack , Installation with accessories , Commissioning of 8 new camera with old instaed system
    End Date 07 Jul 2026 04:00 PM 1 day left
    Location Lucknow, Uttar Pradesh
    Department Department Of Agricultural Research And Education dare
    Amount Refer doc
    Amount: Refer doc
    Indian Council Of Agricultural Research icar
    Expired Today
    Chemicals;19715;Potassium dichromate , Sulphuric acid , Ferrous ammonium sulphate , Diphenyl amine indicator , Orthophosphoric acid , Potassium Permanganate , Sodium Hydroxide , Boric acid , Potassium hydrogen phthalate , Ammonium fluoride , HCl Hydrochloric acid , Stannous Chloride , Sodium bicarbonate , Activated charcoal , Ammonium molybdate , Potassium dihydrogen phosphate , Antimony potassium tartrate , L Ascorbic acid , Ammonium acetate , Potassium chloride , Calcium chloride , Barium chloride , Potassium sulphate , Gum acacia powder , Mono calcium phosphate , Nitric acid , DTPA , TEA , EDTA , Potassium iodide , Thiourea , Magnesium chloride , EBT , Ammonium hydroxide , Ammonium chloride , Sodium sulphate , Copper sulphate , Perchloric acid , 2 3 5 Triphenyl tetrazolium chloride , Glucose , Urea , Ammonium metavanadate , Methanol , TPF Triphenyl formazone , Toluene , Tris hydroxymethyl aminomethane buffer , Malic acid , Citric acid , Borax , P nitrophenol phosphate , P nitrophenol beta D glucoside PNG , Silver sulphate , Ammonium oxalate , Hydrogen peroxide , Sodium citrate , Sodium chloride , Carboxy methyl cellulose , Liquid paraffin , Poly vinyl alcohol , Epoxy propane , Sodium Hexametaphosphate , Potassium p nitrophenyl sulphate , Fluorescein diacetate , Chloroform , Hydrometer Bouyoucos , Thermometer room temperature , Comassie brilliant blue , ABTS , Tartaric acid , Ethyl alcohol , Iso amyl acetate , Glacial acetic acid , Ammonium carbonate , Ammonium Purpurate , Calcium oxide , Calcium sulphate , Zinc chloride 
    End Date Expired
    Location Jhansi, Uttar Pradesh
    Department Department Of Agricultural Research And Education dare
    Amount Refer doc
    Amount: Refer doc
    Indian Council Of Agricultural Research icar
    1 day left
    Repair and Overhauling Service - Tractors (V1); New Holland; Yes; Buyer Premises, Service Provider Premises
    End Date 08 Jul 2026 12:00 PM 1 day left
    Location Jalandhar, Punjab
    Department Department Of Agricultural Research And Education dare
    Amount Refer doc
    Amount: Refer doc
    Indian Council Of Agricultural Research icar
    Expired Today
    G bioscience Brand Only Supply;814;Ethanol extrapure, 500 ml , TBE 10X 0.9M Tris borate 0.01 EDTA pH8.3 , Ethidium Bromide Solution 10mg , Sodium acetate pH5.2 3M , SDS 10 percentage , Rnase A , Water Molecular Grade
    End Date Expired
    Location Bharatpur, Rajasthan
    Department Department Of Agricultural Research And Education dare
    Amount Refer doc
    Amount: Refer doc
    Indian Council Of Agricultural Research icar
    Expired Today
    Tarsons Brand Only Supply;43;Maxiamp 0.2 ml PCR strips Flat cap , microcentrifuge tubes 2 ml , MAXIPENSE Low retention tips 1 200 ul 1000 tips , MAXIPENSe Low retntion tips 100 1000 ul 500 tips , MAXIPENSE Low retention tips 0.5 10 ul 1000 tips , Combi lock rack , Nitrile Gloves Powder Free , Kimwipes Disposable wipes , Hand Protector Grip silicons , Wide Mouth Autoclavable wash bottle PP with blue PP closure 500 ml , Wide Mouth Autoclavable wash bottle PP with blue PP closure 1000 , Beaker with Handle PP 5000ml , Wide Mouth Squre Bottle PP with PP closure
    End Date Expired
    Location Bharatpur, Rajasthan
    Department Department Of Agricultural Research And Education dare
    Amount Refer doc
    Amount: Refer doc
    Indian Council Of Agricultural Research icar
    Expired Today
    Sisco Research Laboratories Brand Only Supply;2009;Phenol Chloroform Isoamyl Alcohol pH 8.0 for molecular biology 500 ml , 6X DNA loading dye 5 ml , Isopropanol IPA GC HS 99 9 Percentage , n Hesane extrapure AR 99 Percentage 2500 ml , Methanol GC HS 99 9 Percenrage
    End Date Expired
    Location Bharatpur, Rajasthan
    Department Department Of Agricultural Research And Education dare
    Amount Refer doc
    Amount: Refer doc
    Indian Council Of Agricultural Research icar
    1 day left
    1;Mono X Net
    End Date 07 Jul 2026 08:00 PM 1 day left
    Location East Champaran, Bihar
    Department Department Of Agricultural Research And Education dare
    Amount Refer doc
    Amount: Refer doc
    Indian Council Of Agricultural Research icar
    21 hours left
    BOQ for;5;Annexure 1 , Annexure 2 , Annexure 3 , Annexure 4 , Annexure 5
    End Date 07 Jul 2026 11:00 AM 21 hours left
    Location Pune, Maharashtra
    Department Department Of Agricultural Research And Education dare
    Amount Refer doc
    Amount: Refer doc
    Indian Council Of Agricultural Research icar
    21 hours left
    Customized AMC/CMC for Pre-owned Products - Non- Comprehensive AMC; HP, Lenovo, Dell, Acer, HCL, Brother, Canon, Epson, IBM, Koha, Assembled; Annual Maintenance Contract (AMC); Annually; Yes
    End Date 07 Jul 2026 11:00 AM 21 hours left
    Location Nagpur, Maharashtra
    Department Department Of Agricultural Research And Education dare
    Amount Refer doc
    Amount: Refer doc
    Indian Council Of Agricultural Research icar
    1 day left
    Chemical for CESPU;24;Hydrate buffer , Miracloth , PCR master mix , cDNA synthesis kit , Yatalase enzyme , Dowex 66 Amberlite FPA66 , 5 Hydroxymethyl Furfural , Dowex 50X8 Na , Pectinose pectin sugar , Pentose , Fungal Growth Medium , SYBr Safe Gel Stain , Disposable bags Bag 14 , Disposable bags Bag 12 , RNA extraction solution , Sepharose special Low , DH5a Competent Cells , Plant and Fungal RNA Isolation Kit , Plasmid DNA Purification kit , Furfural 99 percent , Lysogeny Broth , Beta Nicotinamide adenine dinucleotide
    End Date 07 Jul 2026 05:00 PM 1 day left
    Location Bhopal, Madhya Pradesh
    Department Department Of Agricultural Research And Education dare
    Amount ₹ 5 L
    Amount: ₹ 5 L
    Indian Council Of Agricultural Research icar
    1 day left
    Custom Bid for Services - ANNUAL REPORT PRINTING 100 COPIES
    End Date 07 Jul 2026 03:00 PM 1 day left
    Location Meerut, Uttar Pradesh
    Department Department Of Agricultural Research And Education dare
    Amount Refer doc
    Amount: Refer doc
    Indian Council Of Agricultural Research icar
    1 day left
    200;Temporary Night Shelter for Backyard Chicken
    End Date 07 Jul 2026 05:00 PM 1 day left
    Location Rangareddy, Telangana
    Department Department Of Agricultural Research And Education dare
    Amount Refer doc
    Amount: Refer doc
    Indian Council Of Agricultural Research icar
    1 day left
    Procurement of chemicals;49804;Dimethyl Sulphoxide DMSO , Sodium pyruvate , Dithiothreitol DTT , 3 3 diaminobenzidine DAB , Potassium sulphate , Copper sulphate pentahydrate , Hydrogen peroxide , Nitro Blue Tetrazolium NBT , Toluene , 5 Sulphosalicylic acid , Sodium bicarbonate , Guaiacol , Bradford reagent , Bovine serum albumin Fraction V , 2 4 6 Tri 2 pyridyl 1 3 5 triazine TPTZ , Potassium dihydrogen phosphate , Glacial acetic acid , Orthophosphoric acid , Trichloroacetic acid , Thiobarbituric acid , Acetone
    End Date 08 Jul 2026 01:00 PM 1 day left
    Location Pune, Maharashtra
    Department Department Of Agricultural Research And Education dare
    Amount Refer doc
    Amount: Refer doc
    Indian Council Of Agricultural Research icar
    1 day left
    MOLICULAR BIOLOGY GRADE CHEMICALS;6203;EMPARTA ACS Merck , Silica gel self-indicating coarse Merck , Sodium hydroxide solution c NaOH 2 mol per l 2 N TitriPUR Merck , Sulfuric acid about 98 percent EMPLURA Merck , Tin II chloride dihydrate for analysis EMSURE ACS, ISO, Reag.
    End Date 08 Jul 2026 12:00 PM 1 day left
    Location Mau, Uttar Pradesh
    Department Department Of Agricultural Research And Education dare
    Amount Refer doc
    Amount: Refer doc

    Select a tender to view details

    The Problem

    Why Indian Council Of Agricultural Research icar Tenders Get Rejected at the Technical Stage

    These are the most common rejection reasons our team sees — all 100% avoidable with the right support.

    Documentation Errors
    Incorrect formats or missing mandatory certificates often lead to rejection.
    Submission Delays
    Waiting until the last minute often leads to technical glitches & failure.
    The Solution

    Everything You Need to Win Indian Council Of Agricultural Research icar Tenders — In One Platform

    End-to-end bid support from documentation to order confirmation.

    📁
    Documentation Support
    We prepare your complete technical & financial bid folders — rejection-proof.
    • EMD / Bank Guarantee preparation
    • QR certificate compilation & verification
    • MAF & OEM authorization letters
    💻
    Portal Management
    End-to-end bid submission so you never miss a deadline.
    • Bid submission on portal
    • Document upload & correct tagging
    • Deadline alerts & reminders
    🤝
    Post-Bid Support
    We stay with you from submission to order confirmation.
    • Technical Query (TQ) response
    • Evaluation stage liaisoning
    • LOI / Work Order follow-up
    Our Process

    How It Works — 4 Simple Steps

    1
    Eligibility Check
    WhatsApp company profile, AI checks QR fit within 2 hours
    2
    Document Review
    we audit existing documents against tender requirements
    3
    Bid Preparation
    we prepare all technical & financial folders, 100% compliant
    4
    Submit & Win
    submission supported through evaluation
    FREE DOWNLOAD
    Indian Council Of Agricultural Research icar Tender Checklist:
    10 Must-Have Documents
    The exact checklist our team uses for every Indian Council Of Agricultural Research icar bid — never get rejected for a missing document.
    FAQ

    Frequently Asked Questions about Indian Council Of Agricultural Research icar Bidding

    How to register as a vendor for Indian Council Of Agricultural Research icar?

    Submit the required registration form along with your company registration documents, GST certificate, PAN, and relevant experience certificates on the Indian Council Of Agricultural Research icar vendor portal. You'll also need to clear a financial assessment. GeMTech PARAS manages the entire empanelment process — contact us for a free eligibility assessment.

    What is the EMD requirement for Indian Council Of Agricultural Research icar tenders?

    EMD is typically 2–3% of the estimated tender value, submitted as a Bank Guarantee (BG) from a scheduled commercial bank. The bank branch and BG format must be pre-approved. Submitting a DD or an incorrect BG format is the single most common rejection reason. The exact amount and format are always specified in the NIT — we verify this for every bid we manage.

    Chat with a Indian Council Of Agricultural Research icar tender Expert