14; Clutch Plate Assy OM Caliper Pad Oil Filter Yoke Propeller Shaft Propeller Shaft Flange Spider Bearing Bty Cut off Switch Fuel Pipe Bush Rubber Seat Beats GeMARPTS / Searched Strings used in GeMARPTS Clutch Plate Assy OM Caliper Pad Oil Filter Yoke Propeller Shaft Propeller Shaft Flange Spider Bearing Bty Cut off Switch Fuel Pipe Bush Rubber Seat Beats Searched String : Clutch Plate Assy OM Pressure Plate Wilfit Spares Commercial Dosa Hot Plate Steel Pipe Flanges as per IS 6392 Sprinkler Irrigation Unit as per IS 12232 Searched String : Caliper Pad Skinfold Caliper CALIPERS Chest Depth Caliper V2 Portable Voice Recorder Internal Dial Caliper Gauge Desk Pads - Writing Kellys Pad Scrub Pad Dak Pad V2 Mouse Pad Searched String : Oil Filter Oil Filter Cartridges Filtering Half Mask-Air Pollution Mask-IS 9473 Oil filter assembly for wheel loader Bag filter Laboratory Filter Papers Filter Cartridge Filter Sand 15w - 40 Diesel Engine Oil Pollen filter Wilfit Spares Searched String : Yoke Propeller Shaft Electromagnetic Yoke Machine Self Propelled Tree Maintenance Platform Yoke Collar BHEL Gear Shaft and Pinion Shaft for Increaser Municipal solid waste Twin shaft shredder Flexible Shaft Grinder Shaft as per Drawing

• Login to download

Ord store;1734; Wire steel Mild Twin Jute Cloth Hessain Medium 102 CM Wide Paper Raping Brown Paint RFU White Paint RFU Red Napthalene Balls Bty Dry Flannelette Paint RFU OG Thinner GeMARPTS / Searched Strings used in GeMARPTS Wire Steel Mild 1.00 MM Twin Jute 3 Cloth Hessain Medium 102 CM Wife Paper Raping Brown Paint RFU White Paint RFU Red Napthalene Balls Bty Dry 1.5 Flannelette Paint RFU OG Thinner

• Login to download

Nanoscale Depositor System and Two Photon;5; Nanoscale Depositor System Accessories Vacuum Assembly Accessories Atomic Layer Deposition Precursor and Power Management Two Photon Polymerization System Accessories Reactor Atomic Layer Deposition Chamber GeMARPTS / Searched Strings used in GeMARPTS Nanoscale Depositor System Two Photon Polymerization System with compatible accessories GeMARPTS / Searched Result generated in GeMARPTS Riot Control Helmet with accessories MHA / Relevant Categories selected for notification Vacuum Filtration Assembly

• Login to download

clutch plate;5; Clutch Plate Pressure Plate Self Starter 24V Field Coil 24V Armature GeMARPTS / Searched Strings used in GeMARPTS Clutch Plate Pressure Plate Self Starter 24V Field Coil 24V Armature Assy

• Login to download

948; J1 8340-000007N-510333-510333 COVER WATER PROOF 9.1 X 9.1M K6 3510-000033 LAUNDRY PRESS COMMERCIAL MK-2 K5 6260-000027 BURNER WITH DOME LANTERN HURRICANE S 2 K6 7350-000338 PLASTIC CONTAINER W O LID 5 LTRS K6 7330-000068 UTENSIL COOKING 45 MEN SET KARAHI 305 MM GeMARPTS / Searched Strings used in GeMARPTS speedometer GeMARPTS / Searched Result generated in GeMARPTS Cap FS Disruptive JSS Hand Tufted Carpets as per IS 5884 Sprinkler Irrigation Unit as per IS 12232 / Relevant Categories selected for notification Stock Pot Stove Years of Past Experience Required for same/similar service/ 3 Year s MSE Exemption for Years of Experience and Turnover/ No Startup Exemption for Years of Experience and Turnover/ No

• Login to download

Manpower Outsourcing Services - Minimum wage - Skilled Graduate Admin Manpower Outsourcing Services - Minimum wage - Skilled Secondary School Others Manpower Outsourcing Services - Minimum wage - Unskilled Not Required Healthcare Manpower Outsourcing Services - Minimum wage - Unskilled Not Required Others Manpower Outsourcing Services - Minimum wage - Highly-Skilled Graduate Others Manpower Outsourcing Services - Minimum wage - Highly- Skilled Graduate Healthcare Manpower Outsourcing Services - Minimum wage - Highly-Skilled BAMS Healthcare Manpower Outsourcing Services - Minimum wage - Skilled Diploma Healthcare Contract Period/ 1 Years Minimum Average Annual Turnover of the bidder For 3 Years/ 3 3 30 Lakh s Years of Past Experience Required for same/similar service/ 23 23 5 Year s Past Experience of Similar Services required/ Yes MSE Exemption for Years Of Experience/ and Turnover Yes

• Login to download

1; Repair of Tonbo Sight GeMARPTS / Searched Strings used in GeMARPTS Repair of Tonbo Sight GeMARPTS / Searched Result generated in GeMARPTS Repair Maintenance and Installation of Plant/ Systems/Equipments Version 2 / Relevant Categories selected for notification Thermal Weapon Sight as per MHA QR V2 Years of Past Experience Required for same/similar service/ 2 Year s MSE Exemption for Years of Experience and Turnover/ No Startup Exemption for Years of Experience and Turnover/ No Document required from seller/ Experience CriteriaPast Performance In case any bidder is seeking exemption from Experience / Turnover Criteria the supporting documents to prove his eligibility for exemption must be uploaded for evaluation by the buyer Do you want to show documents uploaded by bidders to all bidders participated in bid/ Yes

• Login to download

1; Plotter Printers V2 Q2 MSE Exemption for Years Of Experience/ Yes Startup Exemption for Years Of Experience/ Yes Document required from seller/ Experience CriteriaCertificate Requested in ATCOEM Authorization Certificate In case any bidder is seeking exemption from Experience / Turnover Criteria the supporting documents to prove his eligibility for exemption must be uploaded for evaluation by the buyer Do you want to show documents uploaded by bidders to all bidders participated in bid/ Yes Bid to RA enabled/3/ 3/ No Type of Bid/Two Packet Bid Time allowed for Technical Clarifications during technical evaluation/ 2 Days Inspection Required By Empanelled Inspection Authority / Agencies pre- registered with GeM No Evaluation Method/ Total value wise evaluation

• Login to download

1; Reciprocating Air Compressors - Electric Motor Driven Q2 Minimum Average Annual Turnover of the bidder For 3 Years/ 3 3 3 Lakh s OEM Average Turnover Last 3 Years/ 3 3 20 Lakh s Years of Past Experience Required for same/similar service/ 23 23 3 Year s MSE Exemption for Years Of Experience/ and Turnover 67 67 Yes Startup Exemption for Years Of Experience/and Turnover67 67 Yes Document required from seller/ Experience CriteriaPast PerformanceBidder TurnoverCertificate Requested in ATCOEM Authorization CertificateOEM Annual TurnoverCompliance of BoQ specification and supporting document In case any bidder is seeking exemption from Experience / Turnover Criteria the supporting documents to prove his eligibility for exemption must be uploaded for evaluation by the buyer

• Login to download

108; Disc Guard Gear Head Assy Bolt Bush Cutter Carburator Assy Bush Cutter Drive Shaft Gear Head Spark Plug Crank Oil Seal Cutting Head Amp Meter Sparking Plug Carburator Assy Fuel On off Switch Meter Time Carburator Assy Honda Bush cutter Carburator Assy Aska Light Sparking plug Bush Cutter Gasket Kit Governer Assy Piston with Gasket Piston Ring Set GeMARPTS / Searched Strings used in GeMARPTS Disc Guard Gear Head Assy Bolt Bush Cutter Carburator Assy Bush Cutter Drive Shaft Gear Head Spark Plug Crank Oil Seal Cutting Head Amp Meter Sparking Plug Carburator Assy Fuel On off Switch Meter Time Carburator Assy Honda Bush cutter Carburator Assy Aska Light Sparking plug Bush Cutter Gasket Kit Governer Assy Piston with Gasket Piston Ring Set Searched String : Disc Guard Stink Guard modular electrical switches and accessories Bed Guard Oxidase disc read only compact disc cd Disc Friction Bitumen Emulsion for Roads - Cationic Type V2 as per IS 8887 Sander Disc Flying Insect Control Traps - Fly Catcher Aluminized Leg Guard Searched String : Gear Head Assy RELAY FRAME ASSY.MCC FRAME ASSY. D.P.LATCH FRAME ASSY 203BS43 BHEL Hexagonal Head Bolts Screws and Nuts of Product Grades A and B as per IS 1364 Gear Shaper Gear couplings Wilfit Spares Gear Puller Gear Lubricants For Enclosed Industrial Gear Drives conforming to IS 8406 Hydraulic Gear Pump Lathe Machine BEL Gear Hobbing Machine

• Login to download

Repair and Overhauling Service - Multifunction Machines MFM RICOH Yes Buyer Premises Repair and Overhauling Service - Computer Printers hp Yes Buyer Premises Repair and Overhauling Service - Online Ups 10 Kva For Critical Infrastructures-IS:13947 IS:9000 BPE Yes Buyer Premises Contract Period/ 20 Days Years of Past Experience Required for same/similar service/ 1 Year s Past Experience of Similar Services required/ Yes MSE Exemption for Years of Experience and Turnover/ No Startup Exemption for Years of Experience and Turnover/ No Document required from seller/ Experience CriteriaBidder TurnoverCertificate Requested in ATCOEM Authorization CertificateOEM Annual Turnover In case any bidder is seeking exemption from Experience / Turnover Criteria the supporting documents to prove his eligibility for exemption must be uploaded for evaluation by the buyer Do you want to show documents uploaded by bidders to all bidders participated in bid/ Yes

• Login to download

1; 11KV CTPT Unit GeMARPTS / Searched Strings used in GeMARPTS 11KV CTPT GeMARPTS / Searched Result generated in GeMARPTS All in One PC Classroom Chairs Special Proofed Canvas / Duck as per IS 6803 Laptop - Notebook Cap FS Disruptive JSS XLPE Cables for Working Voltages From 3.3 KV up to and Including 33 KV as per IS 7098 Part 2 Portable Voice Recorder Net Camouflage Shrimp Type Defence Waste Containers and Accessories - Domestic V2 shoes school pvc boys girls / Relevant Categories selected for notification Control Transformer MSE Exemption for Years Of Experience/and TurnoverYes Startup Exemption for Years Of Experience/and TurnoverYes Document required from seller/ Compliance of BoQ specification and supporting document In case any bidder is seeking exemption from Experience / Turnover Criteria the supporting documents to prove his eligibility for exemption must be uploaded for evaluation by the buyer

• Login to download

66; Alt-R CRISPR-Cas9 crRNA SBE1 g1: TAATACTCCAAACACCAAAC Alt-R CRISPR-Cas9 crRNA SBE1 g2: TCAAACATGGTAATGGAGTG Alt-R CRISPR-Cas9 crRNA SBE1 g3: GATTCGTGGGGCTCGGGGTT Alt-R CRISPR-Cas9 crRNA SBE1 g4: CTTGGGTTTACAGGTTCTGG Alt-R CRISPR-Cas9 crRNA SBE2 g1: GAGAGGGGCATCCCTCCACC Alt-R CRISPR-Cas9 crRNA SBE2 g2: TACAGGAAGTGTTGAAGAGC Alt-R CRISPR-Cas9 crRNA SBE2 g3: GGAAATCAATCCACTCAGGG Alt-R CRISPR-Cas9 crRNA BAM9 g1: GTTGGGACTACTCAAGGGCA Alt-R CRISPR-Cas9 crRNA BAM9 g3: CTTGAGTAGTCCCAACACGG Alt-R CRISPR-Cas9 crRNA BAM3 g1: GGAAAGGATGACTGGGGCCA Alt-R CRISPR-Cas9 crRNA BAM3 g2: AAGGGGTGATGGTGGATGCT Alt-R CRISPR-Cas9 crRNA BAM3 g3: GCTTTCCTGAATACCACTCT Alt-R CRISPR-Cas9 crRNA PRAM g1: CAGCAACCGATTTGATCCCG Alt-R CRISPR-Cas9 crRNA PRAM g2: GTTCCAGACTTGGCTAAAGC Alt-R CRISPR-Cas9 crRNA PRAM g3: CACAATATTCTGATGGCACG Alt-R CRISPR-Cas9 crRNA ST23 g1: TGGCACGGGGAATCTAGACA Alt-R CRISPR-Cas9 crRNA ST23 g2: CGGGAAACCGGACTATAACC Alt-R CRISPR-Cas9 crRNA A48 g1: GAAGGAACGACCTCCAGAAA Alt-R CRISPR-Cas9 crRNA A48 g2: TAACCGTCGCTGGGATCTAT Alt-R CRISPR- Cas9 crRNA A75 g2: ATCACAATCAAGATCCGCAT Alt-R CRISPR-Cas9 crRNA SP g1: GCACGGTTCGAGAAGAGATC Alt-R CRISPR-Cas9 crRNA SP g2: TGAACTGCTTCCTCGGCACG Alt-R CRISPR-Cas9 crRNA SP g3: GGCAGAAACTACGAACGAAG Alt-R CRISPR-Cas9 crRNA XT Alt-R CRISPR-Cas9 tracr RNA Alt-R S. p. HiFi-Cas9 Nuclease V3 Nuclease Free Duplex Buffer 10 2 ml IDTE 1X TE Solution 10 2 ml

• Login to download

Custom Bid for Services - Outsourcing of Operation and Maintenance of 400220 GIS Kala Amb station for a period of three years Similar Category/ Operation And Maintenance Of Substation Contract Period/ 3 Years MSE Exemption for Years of Experience and Turnover/ No Startup Exemption for Years of Experience and Turnover/ No Document required from seller/ Certificate Requested in ATC In case any bidder is seeking exemption from Experience / Turnover Criteria the supporting documents to prove his eligibility for exemption must be uploaded for evaluation by the buyer Do you want to show documents uploaded by bidders to all bidders participated in bid/ Yes Bid to RA enabled/ Yes RA Qualification Rule 50 Lowest Priced Technically Qualified Bidders Type of Bid/Two Packet Bid Time allowed for Technical Clarifications during technical evaluation/ 3 Days

• Login to download

1; All in One PC Q2 OEM Average Turnover Last 3 Years/ 3 3 3 Lakh s Years of Past Experience Required for same/similar service/ 23 23 3 Year s MSE Exemption for Years of Experience and Turnover/ No Startup Exemption for Years of Experience and Turnover/ No Document required from seller/ Experience CriteriaPast PerformanceBidder TurnoverCertificate Requested in ATCOEM Authorization CertificateOEM Annual TurnoverCompliance of BoQ specification and supporting document In case any bidder is seeking exemption from Experience / Turnover Criteria the supporting documents to prove his eligibility for exemption must be uploaded for evaluation by the buyer Do you want to show documents uploaded by bidders to all bidders participated in bid/ Yes Past Performance/80 Bid to RA enabled/No

• Login to download

60; flower pots or planters Q4 MSE Exemption for Years Of Experience/ and Turnover 01 01 Yes Startup Exemption for Years Of Experience/and Turnover01 01 Yes Bid to RA enabled/ No Type of Bid/Two Packet Bid Primary product category flower pots or planters Time allowed for Technical Clarifications during technical evaluation/ 2 Days Inspection Required By Empanelled Inspection Authority / Agencies pre- registered with GeM No Evaluation Method/ Total value wise evaluation Arbitration Clause No Mediation Clause No

• Login to download

1; 2X10KVA Single Phase dual redundant online Inverter GeMARPTS / Searched Strings used in GeMARPTS 2X10KVA Single Phase dual redundant online Inverter GeMARPTS / Searched Result generated in GeMARPTS Servo Control Drive - Servo Motor Operated LVC as per IS 9815 Part 1 Portable Single Operated Rectifier Type DC Arc Welding Set Suitable for Manual Arc Welding Process as per IS 4559 Wet Grinder Industrial Siren / Electrical Siren AC Static Watthour Meters - Energy Meter V2 as per IS 13779 Ammeter - Analog Panel Meter as per IS 1248 Submersible Pump Set Single Phase as per IS 8034 Corrugated Boxes Thyristor Power Unit MIL-STD Digital Grounding System / Relevant Categories selected for notification Inverter Minimum Average Annual Turnover of the bidder For 3 Years/ 3 3 12 Lakh s MSE Exemption for Years of Experience and Turnover/ No Startup Exemption for Years of Experience and Turnover/ No

• Login to download

67; Carburator Assy Bush Cutter Drive Shaft Gear Head Spark Plug Cutting Head Amp Meter Sparking Plug Carburator Assy Fuel On off Switch Meter Time Carburator Assy Honda Bush cutter Carburator Assy Aska Light Sparking plug Bush Cutter Gasket Kit Governer Assy Piston with Gasket Piston Ring Set GeMARPTS / Searched Strings used in GeMARPTS Carburator Assy Bush Cutter Drive Shaft Gear Head Spark Plug Cutting Head Amp Meter Sparking Plug Carburator Assy Fuel On off Switch Meter Time Carburator Assy Honda Bush cutter Carburator Assy Aska Light Sparking plug Bush Cutter Gasket Kit Governer Assy Piston with Gasket Piston Ring Set Searched String : Carburator Assy Bush Cutter Wilfit Spares Sprinkler Irrigation Unit as per IS 12232 Football Shoes Searched String : Drive Shaft Wheel Worm Mobile Storage Compactors Tape Drive Digital Physiograph System Pen Drive Movable File Storage System Compactor Gear Shaft and Pinion Shaft for Increaser Wilfit Spares Flexible Shaft Grinder Wheel Chairs V2 Searched String : Gear Head Gear Shaper Hexagonal Head Bolts Screws and Nuts of Product Grades A and B as per IS 1364 Gear couplings Lathe Machine BEL Gear Puller Gear Lubricants For Enclosed Industrial Gear Drives conforming to IS 8406 Hydraulic Gear Pump Football Shoes Gear Hobbing

• Login to download

1140; 18W LED fixture of size 595x595mm with buy back of CFL 42W fixture 595x595mm Passive infrared occupancy sensor GeMARPTS / Searched Strings used in GeMARPTS Passive infrared occupancy sensor GeMARPTS / Searched Result generated in GeMARPTS Occupancy sensor / Relevant Categories selected for notification Occupancy sensor Minimum Average Annual Turnover of the bidder For 3 Years/ 3 3 12 Lakh s Years of Past Experience Required for same/similar service/ 3 Year s MSE Exemption for Years Of Experience/ and TurnoverYes Startup Exemption for Years Of Experience/ and TurnoverYes

• Login to download

Canteen Service - Best Price on Fixed Menu Rate Model - Vegetarian Non-Vegetarian Breakfast Lunch Dinner Snacks Inside Building Premises exclusive for employees/ patients/ in house personnel Contract Period/ 1 Years Minimum Average Annual Turnover of the bidder For 3 Years/ 3 3 50 Lakh s Years of Past Experience Required for same/similar service/ 23 23 3 Year s Past Experience of Similar Services required/ Yes MSE Exemption for Years of Experience and Turnover/ No Startup Exemption for Years of Experience and Turnover/ No Document required from seller/ Experience CriteriaBidder TurnoverCertificate Requested in ATCAdditional Doc 1 Requested in ATCAdditional Doc 2 Requested in ATCAdditional Doc 3 Requested in ATCAdditional Doc 4 Requested in ATC In case any bidder is seeking exemption from Experience / Turnover Criteria the supporting documents to prove his eligibility for exemption must be uploaded for evaluation by the buyer

• Login to download

Hiring of Consultants - Milestone/Deliverable Based - BHEL EDN Banglore and PSNR Expert BHEL EDN Banglore and PSNR Expert No Onsite Contract Period/ 2 Months 21 Days MSE Exemption for Years of Experience and Turnover/ No Startup Exemption for Years of Experience and Turnover/ No Participation restricted to CPSE seller Yes This bid is reserved for participation only by CPSE sellers and hence CPSE sellers will be exempted from payment of Transaction charges Document required from seller/ Additional Doc 1 Requested in ATCAdditional Doc 2 Requested in ATC In case any bidder is seeking exemption from Experience / Turnover Criteria the supporting documents to prove his eligibility for exemption must be uploaded for evaluation by the buyer Do you want to show documents uploaded by bidders to all bidders participated in bid/ No Bid to RA enabled/ No Type of Bid/Two Packet Bid Time allowed for Technical Clarifications during technical evaluation/ 3 Days

• Login to download

24; Linement Belt SD Coil Spark plug Starting Handle Carburetor Oil Seal Inlet Valve Piston Ring Set Gasket Drum Assy Crank Shaft Fly wheel Belt Fan Pipe GeMARPTS / Searched Strings used in GeMARPTS Linement Belt SD Coil Spark plug Starting Handle Carburetor Oil Seal Inlet Valve Piston Ring Set Gasket Drum Assy Crank Shaft Fly wheel Belt Fan Pipe Searched String : Linement Belt Belt Trainer V - Belts - Endless V - Belt for Industrial Purposes as per IS 2494 leather belt V-Belts - Endless V- Belt For Industrial Purposes - General Purpose-IS:2494 Timing Belt Belt Oil skimmer Industrial Safety Belts and Harnesses as per IS 3521 Conveyer Belt Cleaner synthetic web equipment improved version Multipurpose Tactical Belt MHA Searched String : SD Coil Condenser Coil binding coils or wire loops Tripping Coil Digital Physiograph System Coil Tubular heater Elecric Bells and Accessories as per IS 2268 Electric Coil Stove Point of Care Diagnostic Test Kit - Malaria Rapid Test Kits Moving Coil - BHEL Hot air gun Searched String : Spark plug Spark plugs Connector Mounting Hardware - Multi Plug Spark Arrestor Special Proofed Canvas / Duck as per IS 6803 Electrical Plug Lawn Mowers Plug Gauge Geological compass Rubber Plug Keyboard for Personal Computers V2 as per IS 14441

• Login to download

200; LED Luminaire for Flood Light as per IS 10322 IS 16107 Q3 Self Ballasted LED Lamps for General Lighting Services V2 Conforming to IS 16102 Q2 MSE Exemption for Years of Experience and Turnover/ No Startup Exemption for Years of Experience and Turnover/ No Document required from seller/ Certificate Requested in ATC In case any bidder is seeking exemption from Experience / Turnover Criteria the supporting documents to prove his eligibility for exemption must be uploaded for evaluation by the buyer Do you want to show documents uploaded by bidders to all bidders participated in bid/ No Bid to RA enabled/3/ 3/ Yes RA Qualification Rule H1-Highest Priced Bid Elimination Type of Bid/Two Packet Bid Primary product category LED Luminaire for Flood Light as per IS 10322 IS 16107 Time allowed for Technical Clarifications during technical evaluation/ 2 Days

• Login to download

ACG0017;3260; Dome Dish Set White Envelop 9 x 4 Brown Envelope 9 x 4 Pink Envelope 9 x 4 Small Envelope GeMARPTS / Searched Strings used in GeMARPTS Dome Dish Set white Envelope 9 x 4 Brown Envelope 9x 4 Pink Envelope 9x 4 small envelope

• Login to download

ECHS BoQ 11;171376; ESCITALOPRAM 10MG TAB GLUCOMETER STRIPS ONE TOUCH ULTRA INJ METHYLCOBALAMIN 1000MC plus VITAMIN B6 PYRIDOXINE 100MG plus NICOTINAMIDE 100MG NEUROBION FENOFIBRATE 160 MG TAB METOPROLOL SR 25 MG TAB MOXONIDINE 0.3MG TAB OXCARBAZEPINE 150 MG TAB LEVOSULPIRIDE 75MG plus ESOMEPRAZOLE 40MG CAP S AMLODEPINE 5 MG TAB SALMETEROL 50MCG plus FLUTICASONE PROPIONATE 250MCG SERETIDE ACCUHALER 50per250 TIOTROPIUM BROMIDE 9 MCG 120 METERED DOSES per UNIT INHALER ROTA CAP SERTRALINE 50 MG TAB TAMSULIN 0.4 MG plus DUTASTERIDE 5 MG TAB URIMAX D TAB TOPIRAMATE 50MG TAB VENLAFAXINE 75 MG TAB LATANOPROST 0.005percentage W per V EYE DROPS CARVEDILOL 6.25 MG TAB TRIMETAZIDINE MR 35 MG FLAVEDON MR TAB CLONAZEPAM 0.5MG TAB METOPROLOL 25 MG TAB PYRIDOXIN 100 MG TAB TOLTERODINE 1 MG TAB SYP PERACTIN CYPROHEPTADINE SYP LACTULOSE 100 ML BOTT SYRINGE 10ML SYRINGE 20ML SYRINGE 2ML SYRINGE5ML AMLODIPINE 2.5 MG TAB RABEPRAZOLE 20 MG TAB ACARBOSE 25 MG TAB AMLODEPINE 10MG TAB AZATHIOPRINE 50 MG TAB CARVEDILOL 3.125 MG TAB ED PREDNISOLONE 1percentage GABAPENTIN 300MG TAB per CAP MEDROXY PROGESTRONE 10MG TAB ACYCLOVIR EYE OINTMENT INJ METHYLERGOMETRINE 0.2MG PHENYTOIN SODIUM 100 MG EPTOIN PREGNANCY TEST KIT PIOGLITAZONE 15 MG TAB RAMIPRIL 2.5MG TAB ADHESIVE PLASTER 2.5 ADHESIVE PLASTER 5 TRAMADOL 50 MG CAP IPRAVENT SOLUTION IPRATROPIUM BROMIDE INJ AMIKACIN SULPHATE 250 MGperML LINEZOLID 600 MG TAB SILDENAFIL CITRATE 50 MG TAB CLOBETASOL 0.05 percentage OINT DIGOXIN 0.25 MG TAB GLIPIZIDE 5 MG TAB THYROXINE 25 MCG TAB THALIDOMIDE 50 MG TAB PREGABLIN 75 MG TRIHEXYPHENIDYL 2Mg TAB CYPROTERONE 2MG plus ETHINYL ESTRADIOL 0.035MG DIANE 35 TAB INJ LIGNOCAINE 2percentageWITHOUT ADRENALINE LORAZEPAM 1 MG TAB HYDROXYUREA 500 MG CAP CLOBAZAM 5MG TAB PROPRANOLOL 20 MG TAB BANDAGE TRIANGULAR ROLL BANDAGE 6CM X 4 METRES BANDAGE 2.5CM X 4 METRES BANDAID STRIP BACLOFEN 10 MG TAB CARBAMAZEPINE 200 MG TAB RL FLUID CREPE BANDAGE 15CM CREPE BANDAGE 10CM DARIFENACIN 7.5 MG TAB SITAGLIPTIN 50 MG TAB APIXABAN 5MG TAB BETADINE OINT IBANDRONIC ACID 150MG TAB COTTON 50GM PKT ISOXSUPRINE 10MG TAB ED HOMATROPINE 2percentage COTTON 500GM PKT GAUGE PIECES PLASTER ADHESIVE ZINC OXIDE 7.5CM X 5MTR DIVALPROEX 500 MG TAB CALCIUM ACETATE 500 MG TAB ED CIPROFLOXACIN plus DEXAMETHASONE CHLORTHALIDONE 12.5MG TAB CONDOM CATHRETER BISOPROLOL 2.5MG TAB INJ METOCLOPRAMIDE 5MG per ML COUGH LOZENGES IV SET OIN CLOBETASOL plus SALICYLIC ACID DIPSALIC IV SET MICRO DIVALPROEX 250 MG TAB OINT MICONAZOLE OXCARBAZEPINE 300MG TAB ECG GEL IV CANNULA FEBUXOSTAT 80 MG TAB INDOMETHACIN 25 MG CAP CETRIZINE 10 MG TAB SEVELAMER FOSEAL 800 MG TAB SEVELAMER FOSEAL 400 MG TAB BRIVARACETAM 50MG TAB DONEPEZIL 5 MG TAB CILNIDIPINE 10 MG TAB DAPAGLIFOZIN 5MG TAB LINAGLIPTIN 5 MG TAB THYROXINE 75 MCG TAB THIAMINE 100MG TAB MESALAMINE SUPPOSITORY KNEE CAPS SIZE M FERROUS FUMARATE plus FOLIC ACID HB PLUS AUTRIN MOXONIDINE 0.2MG TAB L S BELT INJ TT TETANUS TOXOID 5 ML Bid Details/ 2 / 109GeMARPTS718 718 / Searched Strings used in GeMARPTS ETIZOLAM 0.5MG TAB ASPIRIN 75MG TAB ASPIRIN 150MG TAB ENALAPRIL 5 MG TAB SOFT CERVICAL COLLAR SIZE M UREA CREAM 50 GM SODIUM CHLORIDE 6 percentage WW EYE OINT HYPERSOL 6 DICYCLOMINE 10MG plus MEFENAMIC ACID 250MG TAB CREMAFFIN LIQUID PARAFFIN 1.25MG plus MAGNESIUM HYDROXIDE 3.75MG plus S170ML SYP GLOVES ORS SACHET ISOXSUPRINE 5MGperML AMP OF 2 ML INJ VOGLIBOSE 0.3MG TAB INSULIN ISOPHANEperNPH 70 percentage plus HUMAN INSULIN INSULIN 30percentage SULPHACETAMIDE 20 percentageW per V EYE DROPS DORZOLAMIDE 2 percentageWperV plus TIMOLOL 0.5 percentageWperV ED CINNARIZINE 25MG TABSTUGERON SALINE NASAL DROPS BROMHEXINE 2MG GUAIFENESIN 50MG MENTHOL 1MG TERBUTALINE 1.25MG SYRUP LULICONAZOLE CREAM HEPARIN 15Gper 20G OINT CILNIDIPINE 5 MG TAB FEXOFENADINE 120MG TAB GLUCOSAMINE 250MG plusCHONDROITIN SULPHATE 200MG CAP LEFLUNOMIDE ARAVA 20 MG TAB LEFLUNOMIDE ARAVA 10 MG TAB ATORVASTATIN 40MG TAB BETADINE MOUTHWASH BISOPROLOL 5MG TAB CORN CAP DULOXETINE 20MG CAP TORASEMIDE 20MG TAB BRIMONIDINE 0.2 percentageW perV EYE DROPS ESCITALOPRAM 10MG TAB GLUCOMETER STRIPS ONE TOUCH ULTRA INJ METHYLCOBALAMIN 1000MC VITAMIN B6 PYRIDOXINE 100MG NICOTINAMIDE 100MG FENOFIBRATE 160MG TAB METOPROLOL SR 25 MG TAB MOXONIDINE 0.3MG TAB OXCARBAZEPINE 150 MG TAB LEVOSULPIRIDE 75MG plus ESOMEPRAZOLE 40MG CAP S AMLODEPINE 5 MG TAB SALMETEROL 50MCG plus FLUTICASONE PROPIONATE 250MCG SERETIDE ACCUHALER 50per250 TIOTROPIUM BROMIDE 9 MCG 120 METERED DOSES per UNIT INHALER ROTA CAP SERTRALINE 50 MG TAB TAMSULIN 0.4 MG plus DUTASTERIDE 5 MG TAB URIMAX -D TAB TOPIRAMATE 50MG TAB VENLAFAXINE 75 MG TAB LATANOPROST 0.005percentage W per V EYE DROPS CARVEDILOL 6.25 MG TAB TRIMETAZIDINE MR 35 MG FLAVEDON MR TAB CLONAZEPAM 0.5MG TAB METOPROLOL 25 MG TAB PYRIDOXIN 100 MG TAB TOLTERODINE 1 MG TAB SYP PERACTIN CYPROHEPTADINE SYP LACTULOSE 100 ML BOTT SYRINGE 10ML SYRINGE 20ML SYRINGE 2ML SYRINGE5ML AMLODIPINE 2.5 MG TAB RABEPRAZOLE 20 MG TAB ACARBOSE 25 MG TAB AMLODEPINE 10MG TAB AZATHIOPRINE 50 MG TAB CARVEDILOL 3.125 MG TAB ED PREDNISOLONE 1percentage GABAPENTIN 300MG TAB per CAP MEDROXY PROGESTRONE 10MG TAB ACYCLOVIR 3percentageWperW EYE OINTMENT INJ METHYLERGOMETRINE 0.2MG PHENYTOIN SODIUM 100 MG EPTOIN PREGNANCY TEST KIT PIOGLITAZONE 15 MG TAB RAMIPRIL 2.5MG TAB ADHESIVE PLASTER 2.5 ADHESIVE PLASTER 5 TRAMADOL 50 MG CAP IPRAVENT SOLUTION IPRATROPIUM BROMIDE INJ AMIKACIN SULPHATE 250 MGperML LINEZOLID 600 MG TAB SILDENAFIL CITRATE 50 MG TAB CLOBETASOL 0.05 percentage OINT DIGOXIN 0.25 MG TAB GLIPIZIDE 5 MG TAB THYROXINE 25 MCG TAB THALIDOMIDE 50 MG TAB PREGABLIN 75 MG TRIHEXYPHENIDYL 2Mg TAB CYPROTERONE 2MG plus ETHINYL ESTRADIOL 0.035MG DIANE 35 TAB INJ LIGNOCAINE 2percentageWITHOUT ADRENALINE LORAZEPAM 1 MG TAB HYDROXYUREA 500 MG CAP CLOBAZAM 5MG TAB PROPRANOLOL 20 MG TAB BANDAGE TRIANGULAR ROLL BANDAGE 6CM X 4 METRES BANDAGE 2.5CM X 4 METRES BANDAID STRIP BACLOFEN 10 MG TAB CARBAMAZEPINE 200 MG TAB RL FLUID CREPE BANDAGE 15CM CREPE BANDAGE 10CM DARIFENACIN 7.5 MG TAB Bid Details/ 3 / 109SITAGLIPTIN 50 MG TAB APIXABAN 5MG TAB BETADINE OINT IBANDRONIC ACID 150MG TAB COTTON 50GM PKT ISOXSUPRINE 10MG TAB ED HOMATROPINE 2percentageWperV COTTON 500GM PKT GAUGE PIECES PLASTER ADHESIVE ZINC OXIDE 7.5CM X 5MTR DIVALPROEX 500 MG TAB CALCIUM ACETATE 500 MG TAB ED CIPROFLOXACIN plus DEXAMETHASONE CHLORTHALIDONE 12.5MG TAB CONDOM CATHRETER BISOPROLOL 2.5MG TAB INJ METOCLOPRAMIDE 5MG per ML COUGH LOZENGES IV SET OIN CLOBETASOL plus SALICYLIC ACID DIPSALIC IV SET MICRO DIVALPROEX 250 MG TAB OINT MICONAZOLE OXCARBAZEPINE 300MG TAB ECG GEL Searched String : IV CANNULA IV Cannula Fixator Dressing Intravenous Cannulas as per IS 10555 - 5 Aortic Cannula Nasal Cannula MTP Cannula iv sets transfusion and infusion equipments Suction Cannula Nasal Oxygen Cannula METRONIDAZOLE IV INFUSION Protective Eye Goggles MHA Searched String : FEBUXOSTAT 80 MG TAB Tab Washer-IS:8068 Cap FS Disruptive JSS First Line Anti TB Drugs for NTEP - Ethambutol 800 mg Tablet books Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Digital Physiograph System Anti TB Drugs - Ethionamide 250 mg Tablets Artemether Lumefantrine Tablets V2 Anti TB Drugs - Isoniazid 300 mg Tablet Special Proofed Canvas / Duck as per IS 6803 Searched String : INDOMETHACIN 25 MG CAP Cap FS Disruptive JSS Anti TB Drugs - Cycloserine 250 mg Capsules centrifuge tubes Peak Cap - Indian Coast Guards Screw Cap Vial Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Amitriptyline Tablets V2 Anti TB Drugs - Ethionamide 250 mg Tablets Black Polyethylene Cover Anti TB Drugs - Levofloxacin 250 mg Tablets Searched String : CETRIZINE 10 MG TAB Anti TB Drugs - Pyridoxine 100 mg Tablets Cap FS Disruptive JSS Anti TB Drugs - Moxifloxacin 100 mg Dispersible Tablet Cetrizine Hydrochloride Anti TB Drugs - Levofloxacin 100 mg Dispersible Tablet Special Proofed Canvas / Duck as per IS 6803 First Line Anti TB Drugs for NTEP - Ethambutol 100 mg Tablets books Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Digital Physiograph System Searched String : SEVELAMER FOSEAL 800 MG TAB First Line Anti TB Drugs for NTEP - Ethambutol 800 mg Tablet Cap FS Disruptive JSS Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet books Anti TB Drugs - Ethionamide 250 mg Tablets Digital Physiograph System Anti TB Drugs - Isoniazid 300 mg Tablet Anti TB Drugs - Linezolid 600 mg Tablets Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Moxifloxacin 400 mg Tablets Searched String : SEVELAMER FOSEAL 400 MG TAB Anti TB Drugs - Moxifloxacin 400 mg Tablets Cap FS Disruptive JSS Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Digital Physiograph System Anti TB Bid Details/ 4 / 109Drugs - Ethionamide 250 mg Tablets books Anti TB Drugs - Isoniazid 300 mg Tablet Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Linezolid 600 mg Tablets METRONIDAZOLE Searched String : BRIVARACETAM 50MG TAB Anti TB Drugs - Pyridoxine 50mg Tablets Online UPS V2 Tab Washer-IS:8068 Cap FS Disruptive JSS Baclofen Hot air oven Overbed Tables DICLOFENAC SODIUM Anti TB Drugs - Ethionamide 250 mg Tablets Small Angle Grinders Searched String : DONEPEZIL 5 MG TAB Donepezil Tablet Cap FS Disruptive JSS Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet books Anti TB Drugs - Ethionamide 250 mg Tablets Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Isoniazid 300 mg Tablet Digital Physiograph System Anti TB Drugs - Linezolid 600 mg Tablets Football Shoes Searched String : CILNIDIPINE 10 MG TAB Anti TB Drugs - Pyridoxine 100 mg Tablets Cap FS Disruptive JSS Anti TB Drugs - Moxifloxacin 100 mg Dispersible Tablet books Anti TB Drugs - Levofloxacin 100 mg Dispersible Tablet Special Proofed Canvas / Duck as per IS 6803 First Line Anti TB Drugs for NTEP - Ethambutol 100 mg Tablets Digital Physiograph System Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Sprinkler Irrigation Unit as per IS 12232 Searched String : DAPAGLIFOZIN 5MG TAB Tab Washer-IS:8068 Desktop Computers Baclofen Cap FS Disruptive JSS Overbed Tables Sofas V2 Anti TB Drugs - Ethionamide 250 mg Tablets Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Pyridoxine 10mg Scored Dispersible Tablet All in One PC Searched String : LINAGLIPTIN 5 MG TAB Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Cap FS Disruptive JSS Anti TB Drugs - Ethionamide 250 mg Tablets Hand Tufted Carpets as per IS 5884 Anti TB Drugs - Isoniazid 300 mg Tablet Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Linezolid 600 mg Tablets books Anti TB Drugs - Moxifloxacin 400 mg Tablets Digital Physiograph System Searched String : THYROXINE 75 MCG TAB Anti TB Drugs - Rifampicin 75 mg Dispersible Tablet Cap FS Disruptive JSS Anti TB Drugs - Pyrazinamide 750mg Dispersible Tablet Levothyroxine Tablet Special Proofed Canvas / Duck as per IS 6803 Clopidogrel Tablets V2 Searched String : THIAMINE 100MG TAB Anti TB Drugs - Isoniazid 100mg Dispersible Tablet Online UPS V2 Tab Washer-IS:8068 Special Proofed Canvas / Duck as per IS 6803 Baclofen Hot air oven Overbed Tables Regulators for Breathing Apparatus Diving Instruments or Accessories Anti TB Drugs - Ethionamide 250 mg Tablets Classroom Stools Searched String : MESALAMINE SUPPOSITORY Bid Details/ 5 / 109Special Proofed Canvas / Duck as per IS 6803 Regulators for Breathing Apparatus Diving Instruments or Accessories Searched String : KNEE CAPS SIZE M KNEE BRACE Size-Medium with Packing Box ALIMCO Rain Coat Suit Prefab Hut / House of Size 6.10 M x 19.52 M as per GeM Drawing Artificial Limbs Prefab Toilet Block of Size 4.88 M x 7.32 M As Per GeM Drawing Knee Braces and Splints V2 Prefab Hut / House of Size 6.10 M X 7.32 M as per GeM Drawing Tactical Knee and Elbow Pad Prefab Hut / House of Size 4.88 M X 19.52 M as per GeM Drawing Medical Centrifuge Searched String : FERROUS FUMARATE plus FOLIC ACID HB PLUS AUTRIN Special Proofed Canvas / Duck as per IS 6803 Searched String : MOXONIDINE 0.2MG TAB Examination Cum Dressing Table with Drainage 0 Online UPS V2 books Disposable Surgical Rubber Gloves - Prepowdered as per IS 13422 Special Proofed Canvas / Duck as per IS 6803 Line Interactive UPS with AVR V2 Sprinkler Irrigation Unit as per IS 12232 Cat 6 Patch cord Cap FS Disruptive JSS Enamelled Round Copper Wire as per IS 13730 Part 0 / Sec 1 Searched String : L S BELT Belt Trainer Almirah Steel V2 leather belt books Timing Belt Ultra low temperature laboratory deep freezer Belt Oil skimmer Industrial Safety Belts and Harnesses as per IS 3521 Conveyer Belt Cleaner Kurta Pyjama Searched String : INJ TT TETANUS TOXOID 5 ML Cap FS Disruptive JSS Special Proofed Canvas / Duck as per IS 6803 Searched String : ETIZOLAM 0.5MG TAB Examination Cum Dressing Table with Drainage 0 Desktop Computers Cap FS Disruptive JSS Online UPS V2 books Cat 6 Patch cord Special Proofed Canvas / Duck as per IS 6803 Surgical Gloves as per IS 4148 Sprinkler Irrigation Unit as per IS 12232 Disposable Surgical Rubber Gloves - Prepowdered as per IS 13422 Searched String : ASPIRIN 75MG TAB Tab Washer-IS:8068 Cotton Towelling and Towels V2 as per IS 7056 Baclofen Cap FS Disruptive JSS Overbed Tables Towels - Hotel Linen Anti TB Drugs - Ethionamide 250 mg Tablets Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Pyridoxine 10mg Scored Dispersible Tablet Cotton Towels as per IS 7056 Searched String : ASPIRIN 150MG TAB Anti TB Drugs - Pyrazinamide 150mg Dispersible Tablet Hot air oven Tab Washer-IS:8068 Cap FS Disruptive JSS Baclofen Cotton Towelling and Towels V2 as per IS 7056 Overbed Tables Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Ethionamide 250 mg Tablets Towels - Hotel Linen Bid Details/ 6 / 109Searched String : ENALAPRIL 5 MG TAB Enalapril Tablet Cap FS Disruptive JSS Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Anti TB Drugs - Ethionamide 250 mg Tablets Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Isoniazid 300 mg Tablet books Anti TB Drugs - Linezolid 600 mg Tablets Digital Physiograph System Anti TB Drugs - Moxifloxacin 400 mg Tablets Searched String : SOFT CERVICAL COLLAR SIZE M Cervical Collar Rain Coat Suit cervical collars or neck braces Prefab Hut / House of Size 6.10 M x 19.52 M as per GeM Drawing Prefab Toilet Block of Size 4.88 M x 7.32 M As Per GeM Drawing Medical Centrifuge Prefab Hut / House of Size 6.10 M X 7.32 M as per GeM Drawing Stud with Nuts Prefab Hut / House of Size 4.88 M X 19.52 M as per GeM Drawing HT Tape Searched String : UREA CREAM 50 GM cleaning or janitorial cart CLOTRIMAZOLE Glass Ionomer Cement for Dentistry Urea Technical as per IS 1781 Bucket Mop Wringer Trolley Urea Phosphate HDPE / PP Woven Sacks for Packaging Fertilizers as per IS 9755 Searched String : SODIUM CHLORIDE 6 percentage WW EYE OINT HYPERSOL 6 Category not available on GeM for the text string uploaded by the buyer Searched String : DICYCLOMINE 10MG plus MEFENAMIC ACID 250MG TAB Mefenamic Acid Tablet Cap FS Disruptive JSS Digital Physiograph System Regulators for Breathing Apparatus Diving Instruments or Accessories Special Proofed Canvas / Duck as per IS 6803 DICYCLOMINE PARACETAMOL Searched String : CREMAFFIN LIQUID PARAFFIN 1.25MG plus MAGNESIUM HYDROXIDE 3.75MG plus S170ML SYP Hand Tufted Carpets as per IS 5884 Searched String : GLOVES thermal gloves Nitrile Coated Hand Gloves Gloves - Handicraft books Cricket gloves Surgical Gloves as per IS 4148 Taekwondo Gloves Industrial Safety Gloves - Leather and Cotton Shooting gloves Rubber Gloves for Electrical Purposes as per IS 4770 Searched String : ORS SACHET ORAL REHYDRATION SALT flower pots or planters Polyethylene Glycol Potassium Chloride Sodium Bicarbonate Sodium Chloride Cap FS Disruptive JSS Spherical Roller Bearing as per IS 6455 trolleys or accessories Special Proofed Canvas / Duck as per IS 6803 surgical isolation or surgical masks Portable Voice Recorder Safety Footwear as per IS 15298 Searched String : ISOXSUPRINE 5MGperML AMP OF 2 ML INJ Disposable Surgical Rubber Gloves - Prepowdered as per IS Bid Details/ 7 / 10913422 Cap FS Disruptive JSS modular electrical switches and accessories Combination of Shower and Eye Wash as per IS 10592 Minifuge nabulizer Lunch Box V2 Shaker Incubator Precast Concrete Pipes With And Without Reinforcement V2 As Per Is 458 Disinfectant Fluids Phenolic Type V3 conforming to IS 1061 Searched String : VOGLIBOSE 0.3MG TAB Examination Cum Dressing Table with Drainage 0 Desktop Computers books Online UPS V2 Special Proofed Canvas / Duck as per IS 6803 Cat 6 Patch cord Sprinkler Irrigation Unit as per IS 12232 Line Interactive UPS with AVR V2 Cap FS Disruptive JSS galvanized steel chain link fence fabric as per IS 2721 Searched String : INSULIN ISOPHANEperNPH 70 percentage plus HUMAN INSULIN INSULIN 30percentage Insulin Premix Injection 30:70::Regular:NPH Insulin Syringe Searched String : SULPHACETAMIDE 20 percentageW per V EYE DROPS Combination Shower and Eye/Face Wash Fountain as per IS 10592-1982 Re-affirmed in 2007 with latest amendments PNG Switch Mode Power Supply SMPS as per IS 14886: Sprinkler Irrigation Unit as per IS 12232 Combination of Shower and Eye Wash as per IS 10592 Flaps for Automotive Vehicles Pneumatic Tyres and Tubes as per IS 9168 Latest Fortified Rice Kernels as per IS 17782 Searched String : DORZOLAMIDE 2 percentageWperV plus TIMOLOL 0.5 percentageWperV ED Brimonidine Tartrate Timolol Maleate Drops V2 Searched String : CINNARIZINE 25MG TABSTUGERON Cinnarizine Dimenhydrinate Cap FS Disruptive JSS Cinnarizine Dimenhydrinate Tablets V2 Digital Physiograph System books Special Proofed Canvas / Duck as per IS 6803 Sprinkler Irrigation Unit as per IS 12232 Football Shoes Searched String : SALINE NASAL DROPS Normal Saline Sodium Chloride Nasal Drops Nasal Cannula Saline Stand Cap FS Disruptive JSS Phosphate Buffered Saline Saline Stand V2 Digital Physiograph System Nasal Pack V2 books Nasal Oxygen Cannula Searched String : BROMHEXINE 2MG GUAIFENESIN 50MG MENTHOL 1MG TERBUTALINE 1.25MG SYRUP Bromhexine Guaifenesin Menthol Terbutaline Cap FS Disruptive JSS Bromhexine Guaifenesin Menthol Terbutaline Syrup V2 Diphenhydramine Hydrochloride Ammonium Chloride Sodium Citrate Menthol Multipurpose or General Test Tubes as per IS 2618 Special Proofed Canvas / Duck as per IS 6803 GLIMEPIRIDE books PARACETAMOL SYRUP Regulators for Breathing Apparatus Diving Instruments or Accessories Searched String : LULICONAZOLE CREAM Bid Details/ 8 / 109Barrier cream mosquito repellant cream spray and lotion Ice cream stick Cream Laid and Cream Wove Paper V2 as per IS 1848 Part 1 SILVER SULPHADIAZINE CREAM electrode solutions or creams or ecg jelly Betamethasone Valerate Cream Natural Cheese Hard Variety Processed Cheese Processed Cheese Spread and Soft Cheese as per IS 2785 Shaving Cream - IS 9740 Betamethasone Valerate Cream V2 Searched String : HEPARIN 15Gper 20G OINT Bucket Mop Wringer Trolley Cap FS Disruptive JSS Foot Operated Pedal Bin or Bucket for Bio - Medical Waste Collection Fistula Needles Sets V2 Online UPS V2 Glass Ionomer Cement for Dentistry Battery Cell as per IS 9128 IS 8144 Waste Containers and Accessories - Domestic V2 Minifuge Electric Kettles and Jugs for Household as per IS 367 Searched String : CILNIDIPINE 5 MG TAB Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Cap FS Disruptive JSS Anti TB Drugs - Ethionamide 250 mg Tablets books Anti TB Drugs - Isoniazid 300 mg Tablet Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Linezolid 600 mg Tablets Digital Physiograph System Anti TB Drugs - Moxifloxacin 400 mg Tablets Football Shoes Searched String : FEXOFENADINE 120MG TAB Fexofenadine Montelukast Online UPS V2 Fexofenadine Montelukast Tablets V2 Tab Washer-IS:8068 Mobile Containers for Solid Waste as per IS 12402 Baclofen Overbed Tables LED Luminaire for High Bay Lighting Anti TB Drugs - Ethionamide 250 mg Tablets Artemether Lumefantrine Oral Liquid Searched String : GLUCOSAMINE 250MG plusCHONDROITIN SULPHATE 200MG CAP Cap FS Disruptive JSS centrifuge tubes Regulators for Breathing Apparatus Diving Instruments or Accessories Digital Physiograph System Special Proofed Canvas / Duck as per IS 6803 Searched String : LEFLUNOMIDE ARAVA 20 MG TAB Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Cap FS Disruptive JSS Anti TB Drugs - Ethionamide 250 mg Tablets books Anti TB Drugs - Isoniazid 300 mg Tablet Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Linezolid 600 mg Tablets Digital Physiograph System Anti TB Drugs - Moxifloxacin 400 mg Tablets Football Shoes Searched String : LEFLUNOMIDE ARAVA 10 MG TAB Anti TB Drugs - Pyridoxine 100 mg Tablets Cap FS Disruptive JSS Anti TB Drugs - Moxifloxacin 100 mg Dispersible Tablet books Anti TB Drugs - Levofloxacin 100 mg Dispersible Tablet Special Proofed Canvas / Duck as per IS 6803 First Line Anti TB Drugs for NTEP - Ethambutol 100 mg Tablets Digital Physiograph System Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Sprinkler Irrigation Unit as per IS 12232 Searched String : ATORVASTATIN 40MG TAB Bid Details/ 9 / 109Atorvastatin Cotton Towelling and Towels V2 as per IS 7056 Tab Washer-IS:8068 Sprinkler Irrigation Unit as per IS 12232 Baclofen Foot Operated Pedal Bin or Bucket for Bio - Medical Waste Collection Overbed Tables Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Ethionamide 250 mg Tablets Insect Killer Searched String : BETADINE MOUTHWASH Sprinkler Irrigation Unit as per IS 12232 Antiseptic Liquid V2 Antiseptic Liquid Digital Physiograph System Cap FS Disruptive JSS Searched String : BISOPROLOL 5MG TAB Tab Washer-IS:8068 Desktop Computers Baclofen Cap FS Disruptive JSS Overbed Tables Sofas V2 Anti TB Drugs - Ethionamide 250 mg Tablets Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Pyridoxine 10mg Scored Dispersible Tablet All in One PC Searched String : CORN CAP Corn flakes Cap FS Disruptive JSS Corn Flour As Per IS 1005 Cap Comforter centrifuge tubes Cap Glacier peak cap surgeon caps or hoods surgeons cap disposable Welding Cap Garbage Bags Searched String : DULOXETINE 20MG CAP Cap Comforter Cleaning Duster V2 Cap Glacier Special Proofed Canvas / Duck as per IS 6803 peak cap Bucket Mop Wringer Trolley Welding Cap Laboratory Vials Blanking cap Online UPS V2 Searched String : TORASEMIDE 20MG TAB Tab Washer-IS:8068 Cleaning Duster V2 Baclofen Special Proofed Canvas / Duck as per IS 6803 Overbed Tables Bucket Mop Wringer Trolley Anti TB Drugs - Ethionamide 250 mg Tablets books Anti TB Drugs - Pyridoxine 10mg Scored Dispersible Tablet Online UPS V2 Searched String : BRIMONIDINE 0.2 percentageW perV EYE DROPS Brimonidine Welding Goggles for Eye Protector as per IS 5983 Brimonidine Tartrate Brinzolamide Brimonidine Tartrate Timolol Maleate Drops V2 Wide - Vision Goggles for Eye - Protector as per IS 5983 Brimonidine Tartrate Brinzolamide Drops V2 Brimonidine Drops V2 Sodium Hyaluronate Drops V2 Searched String : ESCITALOPRAM 10MG TAB Anti TB Drugs - Pyridoxine 10mg Scored Dispersible Tablet Desktop Computers Tab Washer-IS:8068 Cap FS Disruptive JSS Baclofen water baths Overbed Tables Hand Tufted Carpets as per IS 5884 Anti TB Drugs - Ethionamide 250 mg Tablets Online UPS V2 Searched String : GLUCOMETER STRIPS ONE TOUCH ULTRA Blood Glucose Test Strips Glucostrips with Glucometer Hard disk drives Glucose Monitors or Meters - Glucometer Spherical Roller Bearing as per IS 6455 Executive Table Bid Details/ 10 / 109V2 Searched String : INJ METHYLCOBALAMIN 1000MC VITAMIN B6 PYRIDOXINE 100MG NICOTINAMIDE 100MG Hard disk drives Immunoassay Reagents kits Football Shoes Amphotericin B Injection V2 Searched String : FENOFIBRATE 160MG TAB Tab Washer-IS:8068 Sanitary Napkins as per IS 5405 Baclofen books Overbed Tables Servo Control Drive - Servo Motor Operated LVC as per IS 9815 Part 1 Anti TB Drugs - Ethionamide 250 mg Tablets Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Pyridoxine 10mg Scored Dispersible Tablet Molded Case Circuit Breakers MCCB as per IS / IEC 60947 Searched String : METOPROLOL SR 25 MG TAB Metoprolol Tablet Cap FS Disruptive JSS Anti TB Drugs - Ethionamide 250 mg Tablets Anti TB Drugs - Levofloxacin 250 mg Tablets Digital Physiograph System Anti TB Drugs - Cycloserine 250 mg Capsules Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Anti TB Drugs - Isoniazid 300 mg Tablet Anti TB Drugs - Linezolid 600 mg Tablets Searched String : MOXONIDINE 0.3MG TAB Examination Cum Dressing Table with Drainage 0 Desktop Computers books Online UPS V2 Special Proofed Canvas / Duck as per IS 6803 Cat 6 Patch cord Sprinkler Irrigation Unit as per IS 12232 Line Interactive UPS with AVR V2 Cap FS Disruptive JSS galvanized steel chain link fence fabric as per IS 2721 Searched String : OXCARBAZEPINE 150 MG TAB Anti TB Drugs - Linezolid 150 mg Dispersible Tablet Cap FS Disruptive JSS Anti TB Drugs - Rifampicin 150 mg Capsule books Anti TB Drugs - Pyrazinamide 150mg Dispersible Tablet COD Chemical Oxygen Demand Analyzer Closed Reflux Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Ethionamide 250 mg Tablets Football Shoes Searched String : LEVOSULPIRIDE 75MG plus ESOMEPRAZOLE 40MG CAP Cap FS Disruptive JSS Special Proofed Canvas / Duck as per IS 6803 Chlorpheniramine Maleate Dextromethorphan Phenylephrine Tablets V2 centrifuge tubes Searched String : S AMLODEPINE 5 MG TAB Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Sofas V2 Anti TB Drugs - Ethionamide 250 mg Tablets books Anti TB Drugs - Isoniazid 300 mg Tablet Polyester Webbing Slings Anti TB Drugs - Linezolid 600 mg Tablets Cap FS Disruptive JSS Anti TB Drugs - Moxifloxacin 400 mg Tablets Football Shoes Searched String : SALMETEROL 50MCG plus FLUTICASONE PROPIONATE 250MCG SERETIDE ACCUHALER 50per250 Bid Details/ 11 / 109Category not available on GeM for the text string uploaded by the buyer Searched String : TIOTROPIUM BROMIDE 9 MCG 120 METERED DOSES per UNIT INHALER ROTA CAP Category not available on GeM for the text string uploaded by the buyer Searched String : SERTRALINE 50 MG TAB Anti TB Drugs - Pyridoxine 50mg Tablets Cap FS Disruptive JSS Anti TB Drugs - Clofazimine 50 mg Capsules books Anti TB Drugs - Levofloxacin 500 mg Tablets Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Pyrazinamide 500mgTablet Digital Physiograph System Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Football Shoes Searched String : TAMSULIN 0.4 MG plus DUTASTERIDE 5 MG TAB URIMAX -D TAB Special Proofed Canvas / Duck as per IS 6803 Searched String : TOPIRAMATE 50MG TAB Anti TB Drugs - Pyridoxine 50mg Tablets Online UPS V2 Tab Washer-IS:8068 Cap FS Disruptive JSS Baclofen Hot air oven Overbed Tables DICLOFENAC SODIUM Anti TB Drugs - Ethionamide 250 mg Tablets Small Angle Grinders Searched String : VENLAFAXINE 75 MG TAB Anti TB Drugs - Rifampicin 75 mg Dispersible Tablet Cap FS Disruptive JSS Anti TB Drugs - Pyrazinamide 750mg Dispersible Tablet books Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Ethionamide 250 mg Tablets Digital Physiograph System Anti TB Drugs - Isoniazid 300 mg Tablet Clopidogrel Tablets V2 Searched String : LATANOPROST 0.005percentage W per V EYE DROPS Welding Goggles for Eye Protector as per IS 5983 Brimonidine Drops V2 Sodium Hyaluronate Drops V2 Searched String : CARVEDILOL 6.25 MG TAB Ammonia solution 25 Classroom Chairs Anti TB Drugs - Ethionamide 250 mg Tablets books Anti TB Drugs - Levofloxacin 250 mg Tablets Sofa Set Steel Tube 6 - Mercaptopurine Tablet Cap FS Disruptive JSS 6 - Mercaptopurine Tablets V2 modular electrical switches and accessories Searched String : TRIMETAZIDINE MR 35 MG FLAVEDON MR TAB Cap FS Disruptive JSS Compostable Nursery Bags Searched String : CLONAZEPAM 0.5MG TAB Examination Cum Dressing Table with Drainage 0 Desktop Computers Cap FS Disruptive JSS Online UPS V2 books Cat 6 Patch cord Special Proofed Canvas / Duck as per IS 6803 Surgical Gloves as per IS 4148 Sprinkler Irrigation Unit as per IS 12232 Disposable Surgical Rubber Gloves - Bid Details/ 12 / 109GeMARPTS / Searched Result generated in GeMARPTS Prepowdered as per IS 13422 Searched String : METOPROLOL 25 MG TAB Metoprolol Tablet Cap FS Disruptive JSS Anti TB Drugs - Ethionamide 250 mg Tablets Anti TB Drugs - Levofloxacin 250 mg Tablets Digital Physiograph System Anti TB Drugs - Cycloserine 250 mg Capsules Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Anti TB Drugs - Isoniazid 300 mg Tablet Anti TB Drugs - Linezolid 600 mg Tablets Searched String : PYRIDOXIN 100 MG TAB Anti TB Drugs - Pyridoxine 100 mg Tablets Cap FS Disruptive JSS First Line Anti TB Drugs for NTEP - Ethambutol 100 mg Tablets books Anti TB Drugs - Moxifloxacin 100 mg Dispersible Tablet Proteinase K Anti TB Drugs - Levofloxacin 100 mg Dispersible Tablet Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Clofazimine 100 mg Capsules Football Shoes Searched String : TOLTERODINE 1 MG TAB Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Cap FS Disruptive JSS Anti TB Drugs - Ethionamide 250 mg Tablets books Anti TB Drugs - Isoniazid 300 mg Tablet book page separator Anti TB Drugs - Linezolid 600 mg Tablets Football Shoes Anti TB Drugs - Moxifloxacin 400 mg Tablets Special Proofed Canvas / Duck as per IS 6803 Searched String : SYP PERACTIN CYPROHEPTADINE Dual Rapid Test Kit for HIV and Syphilis Special Proofed Canvas / Duck as per IS 6803 Point of Care Diagnostic Test Kit - Syphilis Rapid Test Kits Digital Physiograph System Syphilis Rapid Test Kits Azithromycin Oral Liquid Rapid Plasma Reagin RPR Test Kit for Syphilis V2 Hand Tufted Carpets as per IS 5884 Dual HIV and Syphilis Rapid Diagnostic Test Kit Amoxicillin Clavulanic Oral Liquid Searched String : SYP LACTULOSE 100 ML BOTT Alcohol Based Hand Rub / Hand Sanitizer Hand Tufted Carpets as per IS 5884 Urine Collection Bag V2 Special Proofed Canvas / Duck as per IS 6803 Measured Volume Set V2 Oxygenator Membrane with Hard Shell Reservoir Glass Tableware Cefixime Oral Liquid measured volume set Metal Polish Liquid as per IS 5487 Searched String : SYRINGE 10ML Syringe Filter Desktop Computers syringe pumps Sterile Hypodermic Syringe for Manual use V2 Insulin Syringe water baths Gas Chromatography Syringe Online UPS V2 Research Syringe pump Bucket Mop Wringer Trolley Searched String : SYRINGE 20ML Syringe Filter Cleaning Duster V2 syringe pumps Sterile Hypodermic Syringe for Manual use V2 Insulin Syringe Bucket Mop Wringer Trolley Gas Chromatography Syringe D and C Set Research Syringe pump Online UPS V2 Searched String : SYRINGE 2ML Syringe Filter Waste Containers and Accessories - Domestic Bid Details/ 13 / 109V2 syringe pumps Sterile Hypodermic Syringe for Manual use V2 Insulin Syringe Bucket Mop Wringer Trolley Gas Chromatography Syringe Laminar air flow cabinets or stations Research Syringe pump XLPE Cable for Working Voltages up to and Including 1.1 KV as per IS 7098 Part 1 Searched String : SYRINGE5ML Desktop Computers Digital Physiograph System Sofas V2 Regulators for Breathing Apparatus Diving Instruments or Accessories All in One PC Special Proofed Canvas / Duck as per IS 6803 Surgical Gloves as per IS 4148 Sterile Hypodermic Syringe for Manual use V2 Online UPS V2 XLPE Cable for Working Voltages up to and Including 1.1 KV as per IS 7098 Part 1 Searched String : AMLODIPINE 2.5 MG TAB 5-5 Dithiobis -2-2 Nitrobenzoic Acid XLPE Cable for Working Voltages up to and Including 1.1 KV as per IS 7098 Part 1 5-Sulfosalicylic acid Cap FS Disruptive JSS Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Waste Containers and Accessories - Domestic V2 Anti TB Drugs - Ethionamide 250 mg Tablets books Anti TB Drugs - Isoniazid 300 mg Tablet Disposable Surgical Rubber Gloves - Prepowdered as per IS 13422 Searched String : RABEPRAZOLE 20 MG TAB Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Cap FS Disruptive JSS Anti TB Drugs - Ethionamide 250 mg Tablets books Anti TB Drugs - Isoniazid 300 mg Tablet Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Linezolid 600 mg Tablets Digital Physiograph System Anti TB Drugs - Moxifloxacin 400 mg Tablets Football Shoes Searched String : ACARBOSE 25 MG TAB Anti TB Drugs - Ethionamide 250 mg Tablets Cap FS Disruptive JSS Anti TB Drugs - Levofloxacin 250 mg Tablets books Anti TB Drugs - Cycloserine 250 mg Capsules Digital Physiograph System Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Isoniazid 300 mg Tablet Football Shoes Searched String : AMLODEPINE 10MG TAB Anti TB Drugs - Pyridoxine 10mg Scored Dispersible Tablet Desktop Computers Tab Washer-IS:8068 Cap FS Disruptive JSS Baclofen water baths Overbed Tables Digital Physiograph System Anti TB Drugs - Ethionamide 250 mg Tablets Online UPS V2 Searched String : AZATHIOPRINE 50 MG TAB Azathioprine Tablet Cap FS Disruptive JSS Anti TB Drugs - Pyridoxine 50mg Tablets Azathioprine Tablets V2 Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Clofazimine 50 mg Capsules books Anti TB Drugs - Levofloxacin 500 mg Tablets Digital Physiograph System Anti TB Drugs - Pyrazinamide 500mgTablet Searched String : CARVEDILOL 3.125 MG TAB Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Molded Case Circuit Breakers MCCB as per IS / IEC 60947 Bid Details/ 14 / 109Anti TB Drugs - Ethionamide 125 mg Dispersible Tablet books Anti TB Drugs - Ethionamide 250 mg Tablets Compostable Nursery Bags Anti TB Drugs - Isoniazid 300 mg Tablet Amoxicillin Clavulanic Acid Potassium Clavulanate Tablet Anti TB Drugs - Linezolid 600 mg Tablets Cap FS Disruptive JSS Searched String : ED PREDNISOLONE 1percentage Prednisolone Eye Drops Classroom Chairs Ravens Educational CPM/CVS Special Proofed Canvas / Duck as per IS 6803 DISASSEMBLER COUPLED DEBUGGER WITH HEX EDITOR SOFTWARE Multipara Monitor - Low End Bone Cutting Forceps - Tudor Edwards Pattern books EDM Brass Wire Nitrile Coated Hand Gloves Searched String : GABAPENTIN 300MG TAB per CAP Beret Cap as per IS 5085 Digital Multimeter as per IS 9000 Caps Beret Cap Wool as per IS 5085:1976 Hand Tufted Carpets as per IS 5884 Fabricated PVC - U Fittings for Portable Water Supplies as per IS 10124 LED Luminaire for Flood Light as per IS 10322 IS 16107 Chlorine Tablets as per IS 9825 Cap FS Disruptive JSS Capecitabine Tablets V2 Sanitary Napkins as per IS 5405 Searched String : MEDROXY PROGESTRONE 10MG TAB Anti TB Drugs - Pyridoxine 10mg Scored Dispersible Tablet Cap FS Disruptive JSS Medroxyprogesterone Acetate Tablet Special Proofed Canvas / Duck as per IS 6803 Digital Physiograph System books Sprinkler Irrigation Unit as per IS 12232 Searched String : ACYCLOVIR 3percentageWperW EYE OINTMENT Acyclovir Ointment Eye Drapes Acyclovir Ointment V2 Polypropylene Ropes as per IS 5175 Polyester Round Slings Combination of Shower and Eye Wash as per IS 10592 Protective Eye Goggles MHA Searched String : INJ METHYLERGOMETRINE 0.2MG Online UPS V2 Cap FS Disruptive JSS Disposable Surgical Rubber Gloves - Prepowdered as per IS 13422 Sprinkler Irrigation Unit as per IS 12232 Line Interactive UPS with AVR V2 Regulators for Breathing Apparatus Diving Instruments or Accessories Cat 6 Patch cord Combination of Shower and Eye Wash as per IS 10592 Enamelled Round Copper Wire as per IS 13730 Part 0 / Sec 1 Multimedia Projector MMP Searched String : PHENYTOIN SODIUM 100 MG EPTOIN Anti TB Drugs - Clofazimine 100 mg Capsules Proteinase K Anti TB Drugs - Pyridoxine 100 mg Tablets Hand Tufted Carpets as per IS 5884 First Line Anti TB Drugs for NTEP - Ethambutol 100 mg Tablets CEFOTAXIME SODIUM INJECTION Anti TB Drugs - Moxifloxacin 100 mg Dispersible Tablet Diphenhydramine Hydrochloride Ammonium Chloride Sodium Citrate Menthol Anti TB Drugs - Levofloxacin 100 mg Dispersible Tablet Sodium nitroprusside dihydrate Searched String : PREGNANCY TEST KIT Bid Details/ 15 / 109Pregnancy Rapid Test Kits V2 personal safety kit reflective luminous garments Pregnancy Rapid Test Kits Pregnancy Test Kit for Family Planning Programme Biochemistry Reagent Kits Rheumatoid Factor Test Kit RA Test Kit JAR TEST APPARATUS Widal Test Kit Medical Training kit with Human mannequins for medical education or training Field test kit Searched String : PIOGLITAZONE 15 MG TAB Anti TB Drugs - Linezolid 150 mg Dispersible Tablet Cap FS Disruptive JSS Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Digital Physiograph System Anti TB Drugs - Rifampicin 150 mg Capsule Combination of Shower and Eye Wash as per IS 10592 Anti TB Drugs - Ethionamide 250 mg Tablets Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Isoniazid 300 mg Tablet books Searched String : RAMIPRIL 2.5MG TAB XLPE Cable for Working Voltages up to and Including 1.1 KV as per IS 7098 Part 1 Cap FS Disruptive JSS Waste Containers and Accessories - Domestic V2 books Disposable Surgical Rubber Gloves - Prepowdered as per IS 13422 Special Proofed Canvas / Duck as per IS 6803 Card Board Box for Bio - Medical Waste Collection Sprinkler Irrigation Unit as per IS 12232 Multimedia Projector MMP Football Shoes Searched String : ADHESIVE PLASTER 2.5 5-5 Dithiobis -2-2 Nitrobenzoic Acid XLPE Cable for Working Voltages up to and Including 1.1 KV as per IS 7098 Part 1 Epoxy Adhesive 9323-2 Sprinkler Irrigation Unit as per IS 12232 5-Sulfosalicylic acid Waste Containers and Accessories - Domestic V2 Fabricated PVC - U Fittings for Portable Water Supplies as per IS 10124 medical and surgical adherent tapes for general use or surgical tapes Elastic Surgical Adhesive Tapes V2 plaster dental stone Searched String : ADHESIVE PLASTER 5 plaster dental stone Desktop Computers Plaster Cutting Machine Sprinkler Irrigation Unit as per IS 12232 Dental Type II Plaster of Paris Model Plaster Sofas V2 Cyanoacrylate Adhesive medical and surgical adherent tapes for general use or surgical tapes Threadlocking Adhesive All in One PC Searched String : TRAMADOL 50 MG CAP Anti TB Drugs - Clofazimine 50 mg Capsules Cap FS Disruptive JSS Anti TB Drugs - Pyridoxine 50mg Tablets Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Levofloxacin 500 mg Tablets Culture Tube With Screw Cap Probiotics 50 Billion CFUs Capsules Zidovudine Lamivudine Nevirapine Tablets V2 Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet blood culture bottles Searched String : IPRAVENT SOLUTION IPRATROPIUM BROMIDE Ipratropium Bromide Cap FS Disruptive JSS Ipratropium Bromide Levosalbutamol Ipratropium Bromide Respules V2 Ipratropium Bromide Levosalbutamol Respules V2 Searched String : INJ AMIKACIN SULPHATE 250 MGperML Bid Details/ 16 / 109Magnesium sulphate Injection Special Proofed Canvas / Duck as per IS 6803 AMIKACIN Lithium sulfate monohydrate Ammonium Ferrous Sulphate Digital Physiograph System Ammonium Ferrous Sulphate hexahydrate Sodium Lauryl Sulphate-IS 3986 Silver sulfate Hand Dryer V2 Searched String : LINEZOLID 600 MG TAB Anti TB Drugs - Linezolid 600 mg Tablets Cap FS Disruptive JSS Anti TB Drugs - Linezolid 150 mg Dispersible Tablet Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Ethionamide 250 mg Tablets Regulators for Breathing Apparatus Diving Instruments or Accessories Anti TB Drugs - Isoniazid 300 mg Tablet Digital Physiograph System Anti TB Drugs - Moxifloxacin 400 mg Tablets Searched String : SILDENAFIL CITRATE 50 MG TAB Anti TB Drugs - Pyridoxine 50mg Tablets Cap FS Disruptive JSS Anti TB Drugs - Clofazimine 50 mg Capsules Diethylcarbamazine DEC Tablet Anti TB Drugs - Levofloxacin 500 mg Tablets Special Proofed Canvas / Duck as per IS 6803 Sodium Citrate Food Grade as per IS : 5058 Diphenhydramine Hydrochloride Ammonium Chloride Sodium Citrate Menthol Anti TB Drugs - Pyrazinamide 500mgTablet Digital Physiograph System Searched String : CLOBETASOL 0.05 percentage OINT galvanized steel chain link fence fabric as per IS 2721 Ash Grey Uniform Cat 6 Patch cord Cap FS Disruptive JSS Electric Kettles and Jugs for Household as per IS 367 Switch Mode Power Supply SMPS as per IS 14886: DNA marker Digital Tachometer Potato Peeler nabulizer Searched String : DIGOXIN 0.25 MG TAB Digoxin Tablet Multimedia Projector MMP Anti TB Drugs - Ethionamide 250 mg Tablets Anti TB Drugs - Levofloxacin 250 mg Tablets HF RFID Integrated Reader Examination Cum Dressing Table with Drainage 0 books Anti TB Drugs - Cycloserine 250 mg Capsules Sterile Hypodermic Needles for Single use V2 Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Searched String : GLIPIZIDE 5 MG TAB Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Cap FS Disruptive JSS Anti TB Drugs - Ethionamide 250 mg Tablets books Anti TB Drugs - Isoniazid 300 mg Tablet Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Linezolid 600 mg Tablets Digital Physiograph System Anti TB Drugs - Moxifloxacin 400 mg Tablets Football Shoes Searched String : THYROXINE 25 MCG TAB Anti TB Drugs - Ethionamide 250 mg Tablets Ipratropium Bromide Levosalbutamol Respules V2 Anti TB Drugs - Levofloxacin 250 mg Tablets Levothyroxine Tablet Searched String : THALIDOMIDE 50 MG TAB Anti TB Drugs - Pyridoxine 50mg Tablets Cap FS Disruptive JSS Anti TB Drugs - Clofazimine 50 mg Capsules books Anti TB Drugs - Levofloxacin 500 mg Tablets Special Bid Details/ 17 / 109Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Pyrazinamide 500mgTablet Digital Physiograph System Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Football Shoes Searched String : PREGABLIN 75 MG Anti TB Drugs - Rifampicin 75 mg Dispersible Tablet Cotton Towelling and Towels V2 as per IS 7056 Sulfosulfuron 75 WG Amitriptyline Tablets V2 Magnesium Mg Powder Towels - Hotel Linen URF 75:25- Defence Clopidogrel Tablets V2 FPO - Linseed Oil-IS:75 Cotton Towels as per IS 7056 Searched String : TRIHEXYPHENIDYL 2Mg TAB Tab Washer-IS:8068 Waste Containers and Accessories - Domestic V2 Baclofen Cap FS Disruptive JSS Overbed Tables Bucket Mop Wringer Trolley Anti TB Drugs - Ethionamide 250 mg Tablets GLIMEPIRIDE Anti TB Drugs - Pyridoxine 10mg Scored Dispersible Tablet Laminar air flow cabinets or stations Searched String : CYPROTERONE 2MG plus ETHINYL ESTRADIOL 0.035MG DIANE 35 TAB Category not available on GeM for the text string uploaded by the buyer Searched String : INJ LIGNOCAINE 2percentageWITHOUT ADRENALINE Lignocaine Injection Special Proofed Canvas / Duck as per IS 6803 Adrenaline Injection Football Shoes Adrenaline Injection V2 Cap FS Disruptive JSS Sprinkler Irrigation Unit as per IS 12232 Hand Dryer V2 Digital Physiograph System Searched String : LORAZEPAM 1 MG TAB Lorazepam Tablet Cap FS Disruptive JSS Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Anti TB Drugs - Ethionamide 250 mg Tablets book page separator Anti TB Drugs - Isoniazid 300 mg Tablet books Anti TB Drugs - Linezolid 600 mg Tablets Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Moxifloxacin 400 mg Tablets Searched String : HYDROXYUREA 500 MG CAP Hydroxyurea Capsule Cap FS Disruptive JSS Anti TB Drugs - Levofloxacin 500 mg Tablets CIPROFLOXACIN TINIDAZOLE Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet CEFOTAXIME SODIUM INJECTION Anti TB Drugs - Rifampicin 150 mg Capsule CEFUROXIME AXETIL Anti TB Drugs - Rifampicin 450 mg Capsule TINIDAZOLE Searched String : CLOBAZAM 5MG TAB Clobazam Tablet Desktop Computers Clobazam Tablets V2 Tab Washer-IS:8068 Sofas V2 Baclofen Cap FS Disruptive JSS Overbed Tables All in One PC Anti TB Drugs - Ethionamide 250 mg Tablets Searched String : PROPRANOLOL 20 MG TAB Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Cap FS Disruptive JSS Anti TB Drugs - Ethionamide 250 mg Bid Details/ 18 / 109Tablets books Anti TB Drugs - Isoniazid 300 mg Tablet Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Linezolid 600 mg Tablets Digital Physiograph System Anti TB Drugs - Moxifloxacin 400 mg Tablets Football Shoes Searched String : BANDAGE TRIANGULAR ROLL Triangular Bandage Spherical Roller Bearing as per IS 6455 Calico Triangular Bandage Non Woven Bandage Roll Cast Copper Alloy Screw Down Bib Taps and Stop Valves for Water Services as per IS 781 Cotton Bandage Cloth - IS 863 Thermal Paper Roll Cotton Bandage Cloth V2 Tapered Bearings as per IS 12102 TRIANGULAR LATTICED AERIAL MAST Searched String : BANDAGE 6CM X 4 METRES Plastic Sheet 4 x 50 m for NDRF Towels - Hotel Linen Crepe Bandage V2 Steel Bookcases as per IS 7761 crepe bandage Cotton Towelling and Towels V2 as per IS 7056 Special Proofed Canvas / Duck as per IS 6803 Electrical Box Extension V2 Laminar air flow cabinets or stations water baths Searched String : BANDAGE 2.5CM X 4 METRES Laminar air flow cabinets or stations Crepe Bandage V2 Server Cotton Bandage Cloth V2 crepe bandage Cotton Bandage Cloth - IS 863 Multimedia Projector MMP Elastic Bandage Handloom Cotton Bandage as per IS 863:1988 XLPE Cable for Working Voltages up to and Including 1.1 KV as per IS 7098 Part 1 Searched String : BANDAID STRIP Strip Heater Broom V2 Packing Strip Cap FS Disruptive JSS PVC Strip Curtain Spherical Roller Bearing as per IS 6455 Terminal Strip Connectors Tapered Bearings as per IS 12102 Anaerobic Indicator Strip Rolled Copper and Copper Alloy Sheet Strip and Foil Searched String : BACLOFEN 10 MG TAB Baclofen Cap FS Disruptive JSS Baclofen Tablets V2 books Anti TB Drugs - Pyridoxine 100 mg Tablets Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Moxifloxacin 100 mg Dispersible Tablet Digital Physiograph System Anti TB Drugs - Levofloxacin 100 mg Dispersible Tablet Hand Tufted Carpets as per IS 5884 Searched String : CARBAMAZEPINE 200 MG TAB Carbamazepine Tablet Cap FS Disruptive JSS Carbamazepine Tablets V2 Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Ethionamide 250 mg Tablets Anti TB Drugs - Isoniazid 300 mg Tablet Digital Physiograph System Anti TB Drugs - Linezolid 600 mg Tablets books Searched String : RL FLUID Diesel Exhaust Fluid Blood Fluid Warming Cabinet V2 RBC Diluting Fluid Drawing Trussels / Drawing Board Stand WBC Diluting Fluid Household Disinfectants or Disinfectant Fluids Phenolic Type as per IS 1061 Non Invasive Fluid ONGC Bio - Medical Waste Collection Bags Biohazard Bags Blood and Fluid Warmer Blood or Fluid Warming Bid Details/ 19 / 109Cabinet Searched String : CREPE BANDAGE 15CM crepe bandage Bucket Mop Wringer Trolley Crepe Bandage V2 Elastic Bandage Copper Alloy Fancy Taps for Bathroom as per IS 8931 Latest Triangular Bandage Towels - Hotel Linen orthopedic pop bandage Cotton Towelling and Towels V2 as per IS 7056 Calico Triangular Bandage Searched String : CREPE BANDAGE 10CM crepe bandage Desktop Computers Crepe Bandage V2 Football Shoes Elastic Bandage water baths Triangular Bandage orthopedic pop bandage Towels - Hotel Linen Calico Triangular Bandage Searched String : DARIFENACIN 7.5 MG TAB Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Surgical Gloves as per IS 4148 Anti TB Drugs - Ethionamide 250 mg Tablets books Anti TB Drugs - Isoniazid 300 mg Tablet The Multilayered Cross Laminated Sheets / Tarpaulins / Covers / Agricultural Films as per IS 14611 Anti TB Drugs - Linezolid 600 mg Tablets Cap FS Disruptive JSS Anti TB Drugs - Moxifloxacin 400 mg Tablets Disposable Surgical Rubber Gloves V2 Searched String : SITAGLIPTIN 50 MG TAB Anti TB Drugs - Pyridoxine 50mg Tablets Cap FS Disruptive JSS Anti TB Drugs - Clofazimine 50 mg Capsules books Anti TB Drugs - Levofloxacin 500 mg Tablets Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Pyrazinamide 500mgTablet Digital Physiograph System Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Football Shoes Searched String : APIXABAN 5MG TAB Tab Washer-IS:8068 Desktop Computers Baclofen Cap FS Disruptive JSS Overbed Tables Sofas V2 Anti TB Drugs - Ethionamide 250 mg Tablets Hand Tufted Carpets as per IS 5884 Anti TB Drugs - Pyridoxine 10mg Scored Dispersible Tablet All in One PC Searched String : BETADINE OINT Povidone Iodine Ointment Based Knitted Dressing Cap FS Disruptive JSS Povidone Iodine Ointment Based Knitted Dressing V2 Sprinkler Irrigation Unit as per IS 12232 Acyclovir Ointment V2 Digital Physiograph System POVIDONE IODINE OINTMENT Antiseptic Liquid Acyclovir Ointment Atropine Ointment V2 Searched String : IBANDRONIC ACID 150MG TAB Anti TB Drugs - Pyrazinamide 150mg Dispersible Tablet Stationary Lead Acid Batteries with Tubular Positive Plates in Monobloc Containers as per IS 13369 Folic Acid Tablet Special Proofed Canvas / Duck as per IS 6803 Mefenamic Acid Tablet Stationary Valve Regulated Lead Acid Batteries V2 as per IS 15549 Acetylsalicylic Acid Tablet books Acetylsalicylic Acid Tablet V2 Stationary Cells and Batteries Lead Acid Type with Tubular Positive Plates as per IS 1651 Bid Details/ 20 / 109Searched String : COTTON 50GM PKT Cotton Saree Cleaning Duster V2 Shorts Cotton Industrial Safety Gloves - Leather and Cotton Cotton Stockinette Cotton Towelling and Towels V2 as per IS 7056 Cotton Pillow Cap FS Disruptive JSS Cotton Mattresses Foot Operated Pedal Bin or Bucket for Bio - Medical Waste Collection Searched String : ISOXSUPRINE 10MG TAB Anti TB Drugs - Pyridoxine 10mg Scored Dispersible Tablet Desktop Computers Tab Washer-IS:8068 Cap FS Disruptive JSS Baclofen water baths Overbed Tables Digital Physiograph System Anti TB Drugs - Ethionamide 250 mg Tablets Online UPS V2 Searched String : ED HOMATROPINE 2percentageWperV Ravens Educational CPM/CVS Waste Containers and Accessories - Domestic V2 DISASSEMBLER COUPLED DEBUGGER WITH HEX EDITOR SOFTWARE books Bone Cutting Forceps - Tudor Edwards Pattern Bucket Mop Wringer Trolley EDM Brass Wire Laminar air flow cabinets or stations Zinc Coated EDM Wire V2 XLPE Cable for Working Voltages up to and Including 1.1 KV as per IS 7098 Part 1 Searched String : COTTON 500GM PKT Cotton Saree Cleaning Duster V2 Shorts Cotton Special Proofed Canvas / Duck as per IS 6803 Cotton Stockinette Cotton Towelling and Towels V2 as per IS 7056 Cotton Pillow Regulators for Breathing Apparatus Diving Instruments or Accessories Cotton Mattresses Foot Operated Pedal Bin or Bucket for Bio - Medical Waste Collection Searched String : GAUGE PIECES Plug Gauge Plastic Moulded Chair as per IS 13713 V2 Slip Gauges / Gauge Blocks Kellys Pad Vertical Staff Gauges - IS 4080 Classroom Chairs Gauge Valve - BHEL Male External Catheter Standard Wire Gauge Glass Tableware Searched String : PLASTER ADHESIVE ZINC OXIDE 7.5CM X 5MTR The Multilayered Cross Laminated Sheets / Tarpaulins / Covers / Agricultural Films as per IS 14611 medical and surgical adherent tapes for general use or surgical tapes Elastic Surgical Adhesive Tapes V2 Zinc Oxide Elastic Self - Adhesive Bandage V2 Permeable Nonwoven Surgical Adhesive Tape elastic zinc oxide adhesive bandage Plaster of Paris Bandage V2 Cotton Bandage Cloth V2 Elastic Bandage Elastic Surgical Adhesive Tapes Searched String : DIVALPROEX 500 MG TAB Anti TB Drugs - Levofloxacin 500 mg Tablets Cap FS Disruptive JSS Anti TB Drugs - Pyrazinamide 500mgTablet Football Shoes Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Digital Physiograph System Anti TB Drugs - Ethionamide 250 mg Tablets Combination of Shower and Eye Wash as per IS 10592 Anti TB Drugs - Isoniazid 300 mg Tablet Special Proofed Canvas / Duck as per IS 6803 Bid Details/ 21 / 109Searched String : CALCIUM ACETATE 500 MG TAB Calcium acetate hydrate GLACIAL ACETIC ACID Anti TB Drugs - Levofloxacin 500 mg Tablets Calcium Vitamin D3 Anti TB Drugs - Pyrazinamide 500mgTablet Cap FS Disruptive JSS Medroxyprogesterone Acetate Tablet Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Ammonium acetate Anti TB Drugs - Ethionamide 250 mg Tablets Searched String : ED CIPROFLOXACIN plus DEXAMETHASONE Category not available on GeM for the text string uploaded by the buyer Searched String : CHLORTHALIDONE 12.5MG TAB Anti TB Drugs - Ethionamide 125 mg Dispersible Tablet Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet Cap FS Disruptive JSS Rubberized Weight Dumbbells books Switch Mode Power Supply SMPS as per IS 14886: Special Proofed Canvas / Duck as per IS 6803 shoes school pvc boys girls Sprinkler Irrigation Unit as per IS 12232 Carbon Papers as per IS 1551 Searched String : CONDOM CATHRETER Condom Vending Machine -Automated Male External Catheter Condoms Male External Catheter V2 Condoms Free Supply for Family Planning Programme Condoms for Family Planning Programme Condoms Free Supply for NACO Searched String : BISOPROLOL 2.5MG TAB XLPE Cable for Working Voltages up to and Including 1.1 KV as per IS 7098 Part 1 Cap FS Disruptive JSS Waste Containers and Accessories - Domestic V2 books Disposable Surgical Rubber Gloves - Prepowdered as per IS 13422 Special Proofed Canvas / Duck as per IS 6803 Card Board Box for Bio - Medical Waste Collection Sprinkler Irrigation Unit as per IS 12232 Multimedia Projector MMP Football Shoes Searched String : INJ METOCLOPRAMIDE 5MG per ML Metoclopramide Injection Surgical Gloves as per IS 4148 D and C Set XLPE Cable for Working Voltages up to and Including 1.1 KV as per IS 7098 Part 1 Metoclopramide Tablet Toilet Soap Liquid As Per IS 4199 Combination of Shower and Eye Wash as per IS 10592 Microscopes - Pathological and Research as per IS 4381 IS 5204 IS 4381 IS 5204 Cap FS Disruptive JSS Disposable Syringes as per IS 10258 Searched String : COUGH LOZENGES Cough Assist Device Diphenhydramine Hydrochloride Ammonium Chloride Sodium Citrate Menthol Cough Assist Device V2 Digital Physiograph System books Searched String : IV SET METRONIDAZOLE IV INFUSION Power Generator - DG Set up to 900 KVA iv sets transfusion and infusion equipments Gravity Feed Infusion Set Television TV V2 Bid Details/ 22 / 109Solar IV Curve Tracer Blood Administration Set V2 Dental stone - Type IV Sofa Set Steel Tube emergency iv infusion kit Searched String : OIN CLOBETASOL plus SALICYLIC ACID DIPSALIC Category not available on GeM for the text string uploaded by the buyer Searched String : IV SET MICRO METRONIDAZOLE IV INFUSION Power Generator - DG Set up to 900 KVA iv sets transfusion and infusion equipments White LED Based Solar Street Lighting System for Model I II III And IV Gravity Feed Infusion Set Television TV V2 Solar IV Curve Tracer Dental stone - Type IV Sofa Set Steel Tube emergency iv infusion kit Searched String : DIVALPROEX 250 MG TAB Anti TB Drugs - Ethionamide 250 mg Tablets Cap FS Disruptive JSS Anti TB Drugs - Levofloxacin 250 mg Tablets books Anti TB Drugs - Cycloserine 250 mg Capsules Special Proofed Canvas / Duck as per IS 6803 Anti TB Drugs - Cycloserine 125 mg Capsule / Tablet CIPROFLOXACIN TINIDAZOLE Anti TB Drugs - Isoniazid 300 mg Tablet Digital Physiograph System Searched String : OINT MICONAZOLE Povidone Iodine Ointment Based Knitted Dressing Cap FS Disruptive JSS Povidone Iodine Ointment Based Knitted Dressing V2 Sprinkler Irrigation Unit as per IS 12232 Acyclovir Ointment V2 POVIDONE IODINE OINTMENT Acyclovir Ointment Atropine Ointment V2 Atropine Ointment Mercuric Nitrate Searched String : OXCARBAZEPINE 300MG TAB Tab Washer-IS:8068 Squeegee Washer Wiper Mopper V2 Baclofen Cap FS Disruptive JSS Overbed Tables Napkin Dispenser Anti TB Drugs - Ethionamide 250 mg Tablets books Anti TB Drugs - Pyridoxine 10mg Scored Dispersible Tablet Digital Multimeter as per IS 9000 Searched String : ECG GEL ECG Electrode Gel V2 Air Freshener Solid and Gel ECG Electrodes ECG Machine Blood Sample Collection Tubes ECG Electrodes V2 Electrocardiography ECG Machine V2 ECG RECORDING PAPER Gel Pen V2 ECG Pagewriter machine / Relevant Categories selected for notification Acyclovir Tablets V2 Atazanavir Ritonavir Tablets V2

• Login to download